Cusabio Customized Plasmid
Human MPHOSPH6 cDNA Clone BC029395 pENTR223.1 or pUC Plasmid
(No reviews yet)
Write a Review
- SKU:
- CSB-CL014751HU2
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- MPHOSPH6
- Gene ID:
- 10200
- Accession #:
- BC029395
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Description
Human MPHOSPH6 cDNA Clone BC029395 pENTR223.1 or pUC Plasmid | Cusabio
Gene Name: MPHOSPH6
Gene ID: 10200
Accession Number: BC029395
Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Sequence: ATGGCGGCCGAGAGAAAGACAAAGTTGTCCAAGAATCTGCTGCGCATGAAGTTTATGCAAAGGGGACTGGACTCAGAAACCAAGAAACAACTAGAAGAAGAAGAAAAGAAAATCATTAGTGAAGAGCACTGGTACTTGGATTTGCCAGAGCTTAAAGAGAAAGAGTAG
Length: 168
Related Products
Human MPHOSPH6 cDNA Clone BC005242 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
£171.20
Human MPHOSPH6 cDNA Clone BC005242 pENTR223.1 or pUC Plasmid | CusabioGene Name: MPHOSPH6Gene ID: 10200Accession Number: BC005242Vector: Vector will be determined during the manufacturing process,...
- SKU:
- CSB-CL014751HU1
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- MPHOSPH6
- Gene ID:
- 10200
- Accession #:
- BC005242
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Human MPHOSPH6 cDNA Clone BC031017 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
£171.20
Human MPHOSPH6 cDNA Clone BC031017 pENTR223.1 or pUC Plasmid | CusabioGene Name: MPHOSPH6Gene ID: 10200Accession Number: BC031017Vector: Vector will be determined during the manufacturing process,...
- SKU:
- CSB-CL014751HU3
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- MPHOSPH6
- Gene ID:
- 10200
- Accession #:
- BC031017
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Human MAP2K3 cDNA Clone BC032478 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
£171.20
Human MAP2K3 cDNA Clone BC032478 pENTR223.1 or pUC Plasmid | CusabioGene Name: MAP2K3Gene ID: 5606Accession Number: BC032478Vector: Vector will be determined during the manufacturing process, either...
- SKU:
- CSB-CL013412HU
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- MAP2K3
- Gene ID:
- 5606
- Accession #:
- BC032478
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Human MAPK1IP1L cDNA Clone BC015621 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
£171.20
Human MAPK1IP1L cDNA Clone BC015621 pENTR223.1 or pUC Plasmid | CusabioGene Name: MAPK1IP1LGene ID: 93487Accession Number: BC015621Vector: Vector will be determined during the manufacturing process,...
- SKU:
- CSB-CL850865HU
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- MAPK1IP1L
- Gene ID:
- 93487
- Accession #:
- BC015621
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Human MFSD11 cDNA Clone BC002753 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
£171.20
Human MFSD11 cDNA Clone BC002753 pENTR223.1 or pUC Plasmid | CusabioGene Name: MFSD11Gene ID: 79157Accession Number: BC002753Vector: Vector will be determined during the manufacturing process, either...
- SKU:
- CSB-CL013761HU
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- MFSD11
- Gene ID:
- 79157
- Accession #:
- BC002753
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC