Human LGALS1 cDNA Clone BC001693 pENTR223.1 Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL012882HU
Availability:
3 to 5 Working Days
Size:
10 μg plasmid + 200μl Glycerol
Gene:
LGALS1
Gene ID:
3956
Accession #:
BC001693
Plasmid:
pENTR223.1
€214.00
Frequently bought together:

Description

Human LGALS1 cDNA Clone BC001693 pENTR223.1 Plasmid | Cusabio

Gene Name: LGALS1

Gene ID: 3956

Accession Number: BC001693

Vector: pENTR223.1

Sequence: ATGGCTTGTGGTCTGGTCGCCAGCAACCTGAATCTCAAACCTGGAGAGTGCCTTCGAGTGCGAGGCGAGGTGGCTCCTGACGCTAAGAGCTTCGTGCTGAACCTGGGCAAAGACAGCAACAACCTGTGCCTGCACTTCAACCCTCGCTTCAACGCCCACGGCGACGCCAACACCATCGTGTGCAACAGCAAGGACGGCGGGGCCTGGGGGACCGAGCAGCGGGAGGCTGTCTTTCCCTTCCAGCCTGGAAGTGTTGCAGAGGTGTGCATCACCTTCGACCAGGCCAACCTGACCGTCAAGCTGCCAGATGGATACGAATTCAAGTTCCCCAACCGCCTCAACCTGGAGGCCATCAACTACATGGCAGCTGACGGTGACTTCAAGATCAAATGTGTGGCCTTTGACTGA

Length: 408

View AllClose

0 Reviews

View AllClose