Human LEPREL2 cDNA Clone BC017217 pENTR223.1 or pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL815556HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
LEPREL2
Gene ID:
10536
Accession #:
BC017217
Plasmid:
Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
€347.00
Frequently bought together:

Description

Human LEPREL2 cDNA Clone BC017217 pENTR223.1 or pUC Plasmid | Cusabio

Gene Name: LEPREL2

Gene ID: 10536

Accession Number: BC017217

Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGCACCTGCAGATGCGGGAGGACATGGCTAAGTACAGACGAATGTCGGGAGTTCGGCCCCAGAGCTTCCGGGACCTGGAGACGCCCCCACACTGGGCAGCCTATGACACTGGCCTGGAGCTACTGGGGCGCCAGGAGGCAGGACTGGCACTGCCCAGGCTAGAGGAGGCTCTTCAGGGGAGCCTGGCCCAGATGGAGAGCTGCCGTGCTGACTGTGAGGGGCCTGAGGAGCAGCAGGGGGCTGAAGAAGAGGAGGATGGGGCTGCGAGCCAGGGGGGCCTCTATGAGGCCATTGCAGGACACTGGATTCAGGTCCTGCAGTGCCGGCAACGCTGTGTGGGGGAAACAGCCACACGCCCTGGTCGCAGCTTCCCTGTCCCAGACTTCCTTCCCAACCAGCTGAGGCGGCTACATGAGGCCCATGCTCAGGTGGGCAATCTGTCCCAGGCTATAGAAAATGTCCTGAGTGTCCTGCTCTTCTACCCGGAGGATGAGGCTGCCAAGAGGGCTCTGAACCAGTACCAGGCCCAGCTGGGAGAGCCGAGACCTGGCCTCGGACCCAGAGAGGACATCCAGCGCTTCATCCTCCGATCCCTGGGGGAGAAGAGGCAGCTCTACTATGCCATGGAGCACCTGGGGACCAGCTTCAAGGATCCTGACCCCTGGACCCCTGCAGCTCTCATCCCTGAGGCACTTAGAGAAAAGCTCAGAGAGGATCAAGAGAAGAGGCCTTGGGACCATGAGCCCGTGAAGCCAAAGCCCTTGACCTACTGGAAGGATGTCCTTCTCCTGGAGGGTGTGACCTTGACCCAGGATTCCAGGCAGCTGAATGGGTCGGAGCGGGCGGTGTTGGATGGGCTGCTCACCCCAGCCGAGTGTGGGGTGCTGCTGCAGCTGGCTAAGGATGCAGCTGGGGCTGGAGCCAGGTCTGGCTATCGTGGTCGCCGCTCCCCTCACACCCCCCATGAACGCTTCGAGGGGCTCACGGTGCTTAAGGCTGCGCAGCTGGCCCGGGCTGGGACAGTGGGCAGTCAGGGTGCTAAGCTGCTTCTGGAGGTGAGCGAGCGGGTGCGGACCTTGACCCAGGCCTACTTCTCCCCGGAACGGCCCCTGCATCTGTCCTTCACCCACCTGGTGTGCCGCAGCGCCATAGAAGGAGAGCAAGAGCAGCGCATGGACCTGAGTCACCCAGTGCACGCAGACAACTGCGTCCTGGACCCTGACACGGGAGAGTGCTGGCGGGAGCCCCCAGCCTACACCTATCGGGACTACAGCGGACTCCTCTACCTCAACGATGACTTCCAGGGTGGGGACCTGTTCTTCACGGAGCCCAACGCCCTCACTGTCACGGCTCGGGTGCGTCCTCGCTGTGGGCGCCTTGTGGCCTTCAGCTCCGGTGTCGAGAATCCCCATGGGGTGTGGGCCGTGACTCGGGGACGGCGCTGTGCCCTGGCACTGTGGCACACGTGGGCACCTGAGCACAGGGAGCAGGAGTGGATAGAAGCCAAAGAACTGCTGCAGGAGTCACAGGAGGAGGAGGAAGAGGAAGAGGAAGAAATGCCCAGCAAAGACCCTTCCCCAGAGCCCCCTAGCCGCAGGCACCAGAGGGTCCAAGACAAGACTGGAAGGGCACCTCGGGTTCGGGAGGAGCTGTGA

Length: 1656

View AllClose

0 Reviews

View AllClose