Human LEO1 cDNA Clone BC018147 pENTR223.1 or pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL845150HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
LEO1
Gene ID:
123169
Accession #:
BC018147
Plasmid:
Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
€438.00
Frequently bought together:

Description

Human LEO1 cDNA Clone BC018147 pENTR223.1 or pUC Plasmid | Cusabio

Gene Name: LEO1

Gene ID: 123169

Accession Number: BC018147

Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGGCGGATATGGAGGATCTCTTCGGGAGCGACGCCGACAGCGAAGCTGAGCGTAAAGATTCTGATTCTGGATCTGACTCAGATTCTGATCAAGAGAATGCTGCCTCTGGCAGTAATGCCTCTGGAAGTGAAAGTGATCAGGATGAAAGAGGTGATTCAGGACAACCAAGTAATAAGGAACTGTTTGGAGATGACAGTGAGGACGAGGGAGCTTCACATCATAGTGGTAGTGATAATCACTCTGAAAGATCAGACAATAGATCAGAAGCTTCTGAGCGTTCTGACCATGAGGACAATGACCCCTCAGATGTAGATCAGCACAGTGGATCAGAAGCCCCTAATGATGATGAAGACGAAGGTCATAGATCGGATGGAGGGAGCCATCATTCAGAAGCAGAAGGTTCTGAAAAAGCACATTCAGATGATGAAAAATGGGGCAGAGAAGATAAAAGTGACCAGTCAGATGATGAAAAGATACAAAATTCTGATGATGAGGAGAGGGCACAAGGATCTGATGAAGATAAGCTGCAGAATTCTGACGATGATGAGAAAATGCAGAACACAGATGATGAGGAGAGGCCTCAGCTTTCCGATGATGAGAGACAACAGCTATCTGAGGAGGAAAAGGCTAATTCTGATGATGAACGGCCGGTAGCTTCTGATAATGATGATGAGAAACAGAATTCTGATGATGAAGAACAACCACAGCTGTCTGATGAAGAGAAAATGCAAAATTCTGATGATGAAAGGCCACAGGCCTCAGATGAAGAACACAGGCATTCAGATGATGAAGAGGAACAGGATCATAAATCAGAATCTGCAAGAGGCAGTGATAGTGAAGATGAAGTTTTACGAATGAAACGCAAGAATGCGATTGCATCTGATTCAGAAGCGGATAGTGACACTGAGGTGCCAAAAGATAATAGTGGAACCATGGATTTATTTGGAGGTGCAGATGATATCTCTTCAGGGAGTGATGGAGAAGACAAACCACCTACTCCAGGACAGCCTGTTGATGAAAATGGATTGCCTCAGGATCAACAGGAAGAGGAGCCAATTCCTGAGACCAGAATAGAAGTAGAAATACCCAAAGTAAACACTGATTTAGGAAACGACTTATATTTTGTTAAACTGCCCAACTTTCTCAGTGTAGAGCCCAGACCTTTTGATCCTCAGTATTATGAAGATGAATTTGAAGATGAAGAAATGCTGGATGAAGAAGGTAGAACCAGGTTAAAATTAAAGGTAGAAAATACTATAAGATGGAGGATACGCCGAGATGAAGAAGGAAATGAAATTAAAGAAAGCAATGCTCGGATAGTCAAGTGGTCAGATGGAAGCATGTCCCTGCATTTAGGCAATGAAGTGTTTGATGTGTACAAAGCCCCACTGCAGGGCGACCACAATCATCTTTTTATAAGACAAGGTACTGGTCTACAGGGACAAGCAGTCTTTAAAACGAAACTCACCTTCAGACCTCACTCTACGGACAGTGCCACACATAGAAAGATGACTCTGTCACTTGCAGATAGGTGTTCAAAGACACAGAAGATTAGAATCTTGCCAATGGCTGGTCGTGATCCTGAATGCCAACGCACAGAAATGATTAAGAAAGAAGAAGAACGTTTGAGGGCTTCCATACGTAGGGAATCTCAGCAGCGCCGAATGAGAGAGAAACAGCACCAGCGGGGGCTGAGCGCCAGTTACCTGGAACCTGATCGATACGATGAGGAGGAGGAAGGCGAGGAGTCCATCAGCTTGGCTGCCATTAAAAACCGATATAAAGGGGGCATTCGAGAGGAACGAGCCAGAATCTATTCATCAGACAGTGATGAGGGATCAGAAGAAGATAAAGCTCAAAGATTACTCAAAGCAAAGAAACTTACCAGTGATGAGGAAGGTGAACCTTCCGGAAAGAGAAAAGCAGAAGATGATGATAAAGCAAATAAAAAGCATAAGAAGTATGTGATCAGCGATGAAGAGGAAGAAGATGATGATTGA

Length: 2001

View AllClose

0 Reviews

View AllClose