Human LENG8 cDNA Clone BC028048 pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL822284HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
LENG8
Gene ID:
114823
Accession #:
BC028048
Plasmid:
pUC
€725.00
Frequently bought together:

Description

Human LENG8 cDNA Clone BC028048 pUC Plasmid | Cusabio

Gene Name: LENG8

Gene ID: 114823

Accession Number: BC028048

Vector: pUC

Sequence: ATGGCGGCCAACGTGGGTGATCAACGTAGCACAGATTGGTCTTCTCAGTACAGCATGGTGGCTGGGGCAGGCCGAGAGAATGGCATGGAGACGCCGATGCACGAGAACCCGGAGTGGGAGAAGGCCCGTCAGGCCCTGGCCAGCATCAGCAAGTCAGGAGCTGCCGGCGGCTCTGCCAAGTCCAGCAGCAATGGGCCTGTGGCCAGTGCACAGTACGTGTCCCAGGCAGAAGCCTCAGCTTTGCAGCAGCAGCAGTACTACCAGTGGTACCAGCAGTACAACTATGCCTACCCCTACAGCTACTACTATCCCATGAGCATGTACCAGAGCTATGGCTCCCCTTCCCAGTATGGGATGGCCGGCTCCTATGGCTCAGCCACACCCCAGCAGCCATCCGCACCCCAACACCAAGGGACTCTGAACCAGCCCCCAGTCCCCGGCATGGATGAGAGCATGTCCTACCAGGCTCCCCCTCAGCAGCTGCCGTCGGCTCAGCCCCCTCAGCCCTCAAATCCCCCACATGGGGCTCACACGCTGAACAGTGGCCCTCAGCCTGGGACAGCTCCAGCCACACAGCACAGCCAGGCGGGGCCCGCCACGGGCCAGGCCTATGGGCCACACACCTACACCGAACCTGCCAAGCCCAAGAAGGGCCAACAGCTGTGGAACCGCATGAAACCCGCCCCTGGGACTGGAGGTCTCAAGTTCAACATCCAGAAGCGACCCTTTGCTGTTACCACCCAGAGCTTTGGCTCCAACGCAGAGGGCCAGCACAGTGGTTTTGGCCCCCAGCCCAACCCTGAGAAAGTTCAGAACCACAGCGGGTCCTCTGCCCGGGGGAACCTGTCTGGGAAGCCGGATGACTGGCCCCAGGACATGAAAGAGTATGTGGAGCGCTGCTTCACCGCCTGTGAGTCGGAGGAGGACAAGGACCGCACGGAAAAGCTGCTCAAGGAGGTGCTGCAGGCGCGGCTGCAGGACGGCTCGGCCTATACCATTGACTGGAGCCGGGAGCCCTTGCCGGGGCTGACCCGGGAGCCTGTGGCTGAGAGCCCTAAGAAGAAGCGGTGGGAGGCCGCTAGCAGCCTTCACCCTCCTAGAGGGGCAGGCTCGGCGACAAGGGGCGGGGGTGCCCCGTCCCAGCGAGGGACGCCCGGGGCTGGGGGTGCCGGTCGAGCCCGGGGCAACAGCTTCACCAAGTTTGGCAACCGCAACGTCTTCATGAAGGACAACAGCTCTTCTTCCAGCACAGACTCCCGCTCCCGCTCCTCCTCCAGGTCCCCGACGCGCCACTTCCGCAGAAGTGACTCCCACTCAGACTCCGACAGCTCCTACTCAGGGAATGAGTGTCACCCTGTGGGCCGCAGGAACCCGCCCCCTAAGGGCCGGGGCGGTCGAGGGGCCCATATGGATCGGGGCCGAGGCAGGGCGCAGCGTGGGAAGAGGCACGATCTGGCGCCCACCAAGCGCAGTCGAAAGAAGATGGCGGCGCTGGAGTGTGAGGACCCGGAGCGAGAGCTGAAGAAGCAGAAGCGGGCAGCCCGCTTCCAGCACGGACACTCCCGCCGCCTGCGCCTCGAGCCCCTGGTGCTGCAGATGAGCAGCCTGGAGAGCAGTGGGGCTGACCCTGACTGGCAGGAGCTGCAGATCGTGGGCACCTGCCCTGACATCACCAAGCACTACCTGCGCCTCACCTGTGCCCCCGACCCGTCCACCGTGCGCCCTGTGGCAGTTTTGAAAAAGTCGCTGTGCATGGTCAAGTGCCACTGGAAAGAGAAGCAGGACTACGCGTTTGCCTGCGAGCAGATGAAGTCGATCCGGCAGGATCTGACGGTGCAGGGCATCCGCACCGAGTTCACGGTGGAGGTGTACGAGACCCATGCCCGGATCGCCTTGGAGAAGGGTGACCATGAAGAGTTTAACCAGTGCCAGACGCAGCTCAAGTCGCTGTACGCCGAGAACTTGCCTGGCAATGTGGGCGAGTTTACTGCCTACCGAATCCTCTACTACATCTTCACCAAGAACTCGGGAGACATCACCACGGAGCTGGCATACCTCACACGAGAACTGAAGGCAGATCCTTGCGTGGCCCACGCCTTGGCATTAAGGACAGCCTGGGCCCTGGGCAACTACCACCGCTTTTTCCGGCTCTACTGCCATGCACCCTGCATGTCTGGCTACCTCGTGGACAAGTTTGCAGATCGGGAGCGCAAGGTCGCCCTCAAGGCCATGATCAAAACCTTCCGCCCTGCGCTGCCAGTCTCCTACCTGCAGGCCGAGCTGGCCTTCGAGGGCGAGGCCGCCTGCCGGGCCTTCCTAGAGCCCCTGGGCCTGGCCTACACGGGCCCGGACAACTCCAGCATCGACTGCCGCCTCAGCCTGGCGCAGCTGTCAGCCTTCTGA

Length: 2403

View AllClose

0 Reviews

View AllClose