Human LEMD1 cDNA Clone BC036636 pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL715035HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
LEMD1
Gene ID:
93273
Accession #:
BC036636
Plasmid:
pUC
€241.00
Frequently bought together:

Description

Human LEMD1 cDNA Clone BC036636 pUC Plasmid | Cusabio

Gene Name: LEMD1

Gene ID: 93273

Accession Number: BC036636

Vector: pUC

Sequence: ATGGTGGATGTGAAGTGTCTGAGTGACTGTAAATTGCAGAACCAACTTGAGAAGCTTGGATTTTCACCTGGCCCAATACTACCTTCCACCAGAAAGTTGTATGAAAAAAAGTTAGTACAGTTGTTGGTCTCACCTCCCTGTGCACCACCTGTGATGAATGGACCCAGAGAGCTGGATGGAGCGCAGGACAGTGATGACAGCGAAGAGCTTAATATCATTTTGCAAGGAAATATCATACTCTCAACAAAAAAAAGCAAGAAACTCAAAAAATGGCCTGAGGCTTCCACCACTAAACGCAAAGCTGTAGATACCTATTGCTTGGATTATAAGCCTTCCAAGGGAAGAAGGTGGGCTGCAAGAGCACCAAGCACCAGAATCACATATGGGACTATCACCAAAGAGAGAGACTACTGCGCGGAAGACCAGACTATCGAGAGCTGGAGAGAAGAAGGTTTCCCAGTGGGCTTGAAGCTTGCTGTGCTTGGTATTTTCATCATTGTGGTGTTTGTCTACCTGACTGTGGAAAATAAGTCGCTGTTTGGTTAA

Length: 546

View AllClose

0 Reviews

View AllClose