Human LEFTY2 cDNA Clone BC035718 pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL012858HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
LEFTY2
Gene ID:
7044
Accession #:
BC035718
Plasmid:
pUC
$463.20
Frequently bought together:

Description

Human LEFTY2 cDNA Clone BC035718 pUC Plasmid | Cusabio

Gene Name: LEFTY2

Gene ID: 7044

Accession Number: BC035718

Vector: pUC

Sequence: ATGTGGCCCCTGTGGCTCTGCTGGGCACTCTGGGTGCTGCCCCTGGCTGGCCCCGGGGCGGCCCTGACCGAGGAGCAGCTCCTGGGCAGCCTGCTGCGGCAGCTGCAGCTCAGCGAGGTGCCCGTACTGGACAGGGCCGACATGGAGAAGCTGGTCATCCCCGCCCACGTGAGGGCCCAGTATGTAGTCCTGCTGCGGCGCAGCCACGGGGACCGCTCCCGCGGAAAGAGGTTCAGCCAGAGCTTCCGAGAGGTGGCCGGCAGGTTCCTGGCGTCGGAGGCCAGCACACACCTGCTGGTGTTCGGCATGGAGCAGCGGCTGCCGCCCAACAGCGAGCTGGTGCAGGCCGTGCTGCGGCTCTTCCAGGAGCCGGTCCCCAAGGCCGCGCTGCACAGGCACGGGCGGCTGTCCCCGCGCAGCGCCCAGGCCCGGGTGACCGTCGAGTGGCTGCGCGTCCGCGACGACGGCTCCAACCGCACCTCCCTCATCGACTCCAGGCTGGTGTCCGTCCACGAGAGCGGCTGGAAGGCCTTCGACGTGACCGAGGCCGTGAACTTCTGGCAGCAGCTGAGCCGGCCCCGGCAGCCGCTGCTGCTACAGGTGTCGGTGCAGAGGGAGCATCTGGGCCCGCTGGCGTCCGGCGCCCACAAGCTGGTCCGCTTTGCCTCGCAGGGGGCGCCAGCCGGGCTTGGGGAGCCCCAGCTGGAGCTGCACACCCTGGACCTCAGGGACTATGGAGCTCAGGGCGACTGTGACCCTGAAGCACCAATGACCGAGGGCACCCGCTGCTGCCGCCAGGAGATGTACATTGACCTGCAGGGGATGAAGTGGGCCAAGAACTGGGTGCTGGAGCCCCCGGGCTTCCTGGCTTACGAGTGTGTGGGCACCTGCCAGCAGCCCCCGGAGGCCCTGGCCTTCAATTGGCCATTTCTGGGGCCGCGACAGTGTATCGCCTCGGAGACTGCCTCGCTGCCCATGATCGTCAGCATCAAGGAGGGAGGCAGGACCAGGCCCCAGGTGGTCAGCCTGCCCAACATGAGGGTGCAGAAGTGCAGCTGTGCCTCGGATGGGGCGCTCGTGCCAAGGAGGCTCCAGCCATAG

Length: 1101

View AllClose

0 Reviews

View AllClose