Human LEF1 cDNA Clone BC050632 pENTR223.1 or pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL012856HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
LEF1
Gene ID:
51176
Accession #:
BC050632
Plasmid:
Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
€214.00
Frequently bought together:

Description

Human LEF1 cDNA Clone BC050632 pENTR223.1 or pUC Plasmid | Cusabio

Gene Name: LEF1

Gene ID: 51176

Accession Number: BC050632

Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGCCCCAACTCTCCGGAGGAGGTGGCGGCGGCGGGGGGGACCCGGAACTCTGCGCCACGGACGAGATGATCCCCTTCAAGGACGAGGGCGATCCTCAGAAGGAAAAGATCTTCGCCGAGATCAGTCATCCCGAAGAGGAAGGCGATTTAGCTGACATCAAGTCTTCCTTGGTGAACGAGTCTGAAATCATCCCGGCCAGCAACGGACACGAGGTGGCCAGACAAGCACAAACCTCTCAGGAGCCCTACCACGACAAGGCCAGAGAACACCCCGATGACGGAAAGCATCCAGATGGAGGCCTCTACAACAAGGGACCCTCCTACTCGAGTTATTCCGGGTACATAATGATGCCAAATATGAATAACGACCCATACATGTCAAATGGATCTCTTTCTCCACCCATCCCGAGAACATCAAATAAAGTGCCCGTGGTGCAGCCATCCCATGCGGTCCATCCTCTCACCCCCCTCATCACTTACAGTGACGAGCACTTTTCTCCAGGATCACACCCGTCACACATCCCATCAGATGTCAACTCCAAACAAGGCATGTCCAGACATCCTCCAGCTCCTGATATCCCTACTTTTTATCCCTTGTCTCCGGGTGGTGTTGGACAGATCACCCCACCTCTTGGCTGGCAAGGTCAGCCTGTATATCCCATCACGGGTGGATTCAGGCAACCCTACCCATCCTCACTGTCAGTCGACACTTCCATGTCCAGGTTTTCCCATCATATGATTCCCGGTCCTCCTGGTCCCCACACAACTGGCATCCCTCATCCAGCTATTGTAACACCTCAGGTCAAACAGGAACATCCCCACACTGACAGTGACCTAATGCACGTGAAGCCTCAGCATGAACAGAGAAAGGAGCAGGAGCCAAAAAGACCTCACATTAAGAAGCCTCTGAATGCTTTTATGTTATACATGAAAGAAATGAGAGCGAATGTCGTTGCTGAGTGTACTCTAAAAGAAAGTGCAGCTATCAACCAGATTCTTGGCAGAAGGTGGCATGCCCTCTCCCGTGAAGAGCAGGCTAAATATTATGAATTAGCACGGAAAGAAAGACAGCTACATATGCAGCTTTATCCAGGCTGGTCTGCAAGAGACAATTATGGTAAGAAAAAGAAGAGGAAGAGAGAGAAACTACAGGAATCTGCATCAGGTACAGGTCCAAGAATGACAGCTGCCTACATCTGA

Length: 1200

View AllClose

0 Reviews

View AllClose