Human LECT1 cDNA Clone BC025659 pENTR223.1 Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL012854HU
Availability:
3 to 5 Working Days
Size:
10 μg plasmid + 200μl Glycerol
Gene:
LECT1
Gene ID:
11061
Accession #:
BC025659
Plasmid:
pENTR223.1
€214.00
Frequently bought together:

Description

Human LECT1 cDNA Clone BC025659 pENTR223.1 Plasmid | Cusabio

Gene Name: LECT1

Gene ID: 11061

Accession Number: BC025659

Vector: pENTR223.1

Sequence: ATGACAGAGAACTCCGACAAAGTTCCCATTGCCCTGGTGGGACCTGATGACGTGGAATTCTGCAGCCCCCCGGCGTACGCTACGCTGACGGTGAAGCCCTCCAGCCCCGCGCGGCTGCTCAAGGTGGGAGCCGTGGTCCTCATTTCGGGAGCTGTGCTGCTGCTCTTTGGGGCCATCGGGGCCTTCTACTTCTGGAAGGGGAGCGACAGTCACATTTACAATGTCCATTACACCATGAGTATCAATGGGAAATTACAAGATGGGTCAATGGAAATAGACGCTGGGAACAACTTGGAGACCTTTAAAATGGGAAGTGGAGCTGAAGAAGCAATTGCAGTTAATGATTTCCAGAATGGCATCACAGGAATTCGTTTTGCTGGAGGAGAGAAGTGCTACATTAAAGCGCAAGTGAAGGCTCGTATTCCTGAGGTGGGCGCCGTGACCAAACAGAGCATCTCCTCCAAACTGGAAGGCAAGATCATGCCAGTCAAATATGAAGAAAATTCTCTTATCTGGGTGGCTGTAGATCAGCCTGTGAAGGACAACAGCTTCTTGAGTTCTAAGGTGTTAGAACTCTGCGGTGACCTTCCTATTTTCTGGCTTAAACCAACCTATCCAAAAGAAATCCAGAGGGAAAGAAGAGAAGTGGTAAGAAAAATTGTTCCAACTACCACAAAAAGACCACACAGTGGACCACGGAGCAACCCAGGCGCTGGAAGACTGAATAATGAAACCAGACCCAGTGTTCAAGAGGACTCACAAGCCTTCAATCCTGATAATCCTTATCATCAGGAAGGGGAAAGCATGACATTCGACCCTAGACTGGATCACGAAGGAATCTGTTGTATAGAATGTAGGCGGAGCTACACCCACTGCCAGAAGATCTGTGAACCCCTGGGGGGCTATTACCCATGGCCTTATAATTATCAAGGCTGCCGTTCGGCCTGCAGAGTCATCATGCCATGTAGCTGGTGGGTGGCCCGTATCTTGGGCATGGTGTGA

Length: 1002

View AllClose

0 Reviews

View AllClose