Human LDOC1 cDNA Clone BC003104 pENTR223.1 or pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL012851HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
LDOC1
Gene ID:
23641
Accession #:
BC003104
Plasmid:
Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
€214.00
Frequently bought together:

Description

Human LDOC1 cDNA Clone BC003104 pENTR223.1 or pUC Plasmid | Cusabio

Gene Name: LDOC1

Gene ID: 23641

Accession Number: BC003104

Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGGTGGATGAGTTGGTGCTGCTGCTGCACGCGCTCCTGATGCGGCACCGCGCCCTGAGCATCGAGAACAGCCAGCTCATGGAACAGCTGCGGCTGCTGGTGTGCGAGAGGGCCAGCCTGCTGCGCCAGGTACGTCCGCCGAGCTGCCCGGTGCCCTTCCCCGAAACGTTTAATGGCGAGAGCTCCCGGCTCCCCGAGTTTATCGTGCAGACGGCGTCTTACATGCTCGTGAACGAGAACCGATTCTGCAACGACGCCATGAAGGTGGCATTCCTAATCAGCCTCCTCACCGGGGAAGCCGAGGAGTGGGTGGTGCCCTACATCGAGATGGATAGCCCCATCCTAGGTGATTACCGGGCCTTCCTCGATGAGATGAAACAGTGCTTTGGCTGGGATGACGACGAAGACGACGACGACGAAGAAGAGGAGGATGATTATTAG

Length: 441

View AllClose

0 Reviews

View AllClose