Human LDLRAP1 cDNA Clone BC029770 pENTR223.1 or pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL729190HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
LDLRAP1
Gene ID:
26119
Accession #:
BC029770
Plasmid:
Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
€214.00
Frequently bought together:

Description

Human LDLRAP1 cDNA Clone BC029770 pENTR223.1 or pUC Plasmid | Cusabio

Gene Name: LDLRAP1

Gene ID: 26119

Accession Number: BC029770

Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGCTGTTCAGCCTCAAGTACCTGGGCATGACGCTAGTGGAGCAGCCCAAGGGTGAGGAGCTGTCGGCCGCCGCCATCAAGAGGATCGTGGCTACAGCTAAGGCCAGTGGGAAGAAGCTGCAGAAGGTGACTCTGAAGGTGTCGCCACGGGGAATTATCCTGACAGACAACCTCACCAACCAGCTCATTGAGAACGTGTCCATATACAGGATCTCCTATTGCACAGCAGACAAGATGCACGACAAGGTGTTTGCATACATCGCCCAGAGCCAGCACAACCAGAGCCTCGAGTGCCACGCCTTCCTCTGCACCAAGCGGAAGATGGCACAGGCTGTTACCCTCACCGTAGCCCAGGCCTTCAAAGTCGCCTTTGAGTTTTGGCAGGTGTCCAAGGAAGAGAAAGAGAAGAGGGACAAAGCCAGCCAAGAGGGAGGGGACGTCCTGGGGGCCCGCCAAGACTGCACCCCCCCCTTGAAGAGCTTGGTCGCCACTGGGAACCTGCTGGACTTAGAGGAGACGGCTAAGGCCCCGCTGTCCACGGTCAGCGCCAACACCACCAACATGGACGAGGTGCCGCGGCCACAAGCCTTGAGTGGCAGCAGTGTTGTCTGGGAGCTGGATGATGGCCTGGATGAAGCGTTTTCGAGGCTTGCCCAGTCTCGGACAAACCCTCAGGTCCTGGACACTGGCCTGACAGCCCAGGACATGCATTACGCCCAGTGCCTCTCGCCTGTCGACTGGGACAAGCCTGACAGCAGCGGCACAGAGCAGGATGACCTCTTCAGCTTCTGA

Length: 792

View AllClose

0 Reviews

View AllClose