Human LDLRAD3 cDNA Clone BC042754 pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL803154HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
LDLRAD3
Gene ID:
143458
Accession #:
BC042754
Plasmid:
pUC
€370.00
Frequently bought together:

Description

Human LDLRAD3 cDNA Clone BC042754 pUC Plasmid | Cusabio

Gene Name: LDLRAD3

Gene ID: 143458

Accession Number: BC042754

Vector: pUC

Sequence: ATGTGGCTGCTGGGGCCGCTGTGCCTGCTGCTGAGCAGCGCCGCGGAGAGCCAGCTGCTCCCCGGGAACAACTTCACCAATGAGTGCAACATACCAGGCAACTTCATGTGCAGCAATGGACGGTGCATCCCGGGCGCCTGGCAGTGTGACGGGCTGCCTGACTGCTTCGACAAGAGTGATGAGAAGGAGTGCCCCAAGGCTAAGTCGAAATGTGGCCCAACCTTCTTCCCCTGTGCCAGCGGCATCCATTGCATCATTGGTCGCTTCCGGTGCAATGGGTTTGAGGACTGTCCCGATGGCAGCGATGAAGAGAACTGCACAGCAAACCCTCTGCTTTGCTCCACCGCCCGCTACCACTGCAAGAACGGCCTCTGTATTGACAAGAGCTTCATCTGCGATGGACAGAATAACTGTCAAGACAACAGTGATGAGGAAAGCTGTGAAAGTTCTCAAGAACCCGGCAGTGGGCAGGTGTTTGTGACTTCAGAGAACCAACTTGTGTATTACCCCAGCATCACCTATGCCATCATCGGCAGCTCCGTCATTTTTGTGCTGGTGGTGGCCCTGCTGGCACTGGTCTTGCACCACCAGCGGAAGCGGAACAACCTCGTGACGCTGCCCGTGCACCGGCTGCAGCACCCTGTGCTGCTGTCCCGCCTGGTGGTCCTGGACCACCCCCACCACTGCAACGTCACCTACAACGTCAATAATGGCATCCAGTATGTGGCCAGCCAGGCGGAGCAGAATGCGTCGGAAGTAGGCTCCCCACCCTCCTACTCCGAGGCCTTGCTGGACCAGAGGCCTGCGTGGTATGACCTTCCTCCACCGCCCTACTCTTCTGACACGGAATCTCTGAACCAAGCCGACCTGCCCCCCTACCGCTCCCGGTCCGGGAGTGCCAACAGTGCCAGCTCCCAGGCAGCCAGCAGCCTCCTGAGCGTGGAAGACACCAGCCGCAGCCCGGGGCAGCCTGGCCCCCAGGAGGGCACTGCTGAGCCCAGGGACTCTGAGCCCAGCCAGGGCACTGAAGAAGTATAA

Length: 1038

View AllClose

0 Reviews

View AllClose