Human LDLRAD1 cDNA Clone BC127708 pENTR223.1 or pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL729206HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
LDLRAD1
Gene ID:
388633
Accession #:
BC127708
Plasmid:
Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
€214.00
Frequently bought together:

Description

Human LDLRAD1 cDNA Clone BC127708 pENTR223.1 or pUC Plasmid | Cusabio

Gene Name: LDLRAD1

Gene ID: 388633

Accession Number: BC127708

Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGAACAAGGTCTTCCCCCAGGGAGAGAATGGCTACACTGCTGCTGAATCCAAAGCCCACCCTGGAGGGGAAGCAGGCGGCGGCCACCTCTGCTGCTCACGTCGCGGGGCCTGCCTCTCTGCCTCTCTGCTGCTCCTCCTGGCAACTGTGGCGGCCCTCATCGCCTTGGTCACCATTCTTGGACTCCCATCATGCACCCCAGGAGCCCAAGCTTGTATAACACTGACAAACAGGACAGGCTTCTTGTGCCATGACCAGAGGAGCTGCATTCCAGCCAGTGGGGTCTGTGATGGCGTTCGCACCTGTACCCACGGCGAGGACGAGGATGAGAGCTTGTGCCGAGATGTGCCCCAGAGCCTCCCCCACTTCCTTGTGGCCCACTGTGGAGACCCGGCCTCCTGGATCTACTCAGACCAAAAATGTGATGGCACTAACAACTGCGGGGACTGTTCAGATGAACTGAGCCCAGTAACTGTGTGCCCACCCTGCGGCCCTGGGTGGTGGCGCTGTCCTTCAACCTTCTTCAAGTACTGCGACTGTATACCGAGGCATCTCTGCCGCGACCATGTACAGCACTGCTCCGACTGGTCCGATGAGTATGCCTGTCCCGGACCCTGA

Length: 618

View AllClose

0 Reviews

View AllClose