Human LDHD cDNA Clone BC047902 pENTR223.1 or pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL801250HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
LDHD
Gene ID:
197257
Accession #:
BC047902
Plasmid:
Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
€347.00
Frequently bought together:

Description

Human LDHD cDNA Clone BC047902 pENTR223.1 or pUC Plasmid | Cusabio

Gene Name: LDHD

Gene ID: 197257

Accession Number: BC047902

Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGGCCCGACTGCTCAGGTCTGCAACCTGGGAGCTGTTCCCCTGGAGGGGCTACTGCTCCCAGAAGGCAAAGGGAGAGCTCTGCAGGGACTTCGTAGAGGCTCTGAAGGCCGTGGTGGGCGGCTCCCACGTGTCCACTGCCGCGGTGGTCCGAGAGCAGCACGGGCGCGATGAGTCGGTGCACAGGTGCGAACCTCCTGATGCTGTGGTGTGGCCCCAGAACGTGGAGCAGGTCAGCCGGCTGGCAGCCCTGTGCTATCGCCAAGGTGTGCCCATCATCCCATTCGGCACCGGCACCGGGCTTGAGGGTGGCGTCTGTGCTGTGCAGGGCGGCGTCTGCGTTAACCTGACGCATATGGACCGAATCCTGGAGCTGAACCAGGAGGACTTCTCTGTGGTGGTGGAGCCAGGTGTCACCCGCAAAGCCCTCAACGCCCACCTGCGGGACAGCGGCCTCTGGTTTCCCGTGGACCCAGGCGCGGACGCCTCTCTCTGTGGCATGGCGGCCACCGGGGCGTCGGGGACCAACGCGGTCCGCTACGGCACCATGCGGGACAACGTGCTCAACCTGGAGGTGGTGCTGCCCGACGGGCGGCTGCTGCACACGGCGGGCCGAGGCCGGCATTTCCGCTTCGGCTTCTGGCCAGAAATCCCTCATCACACAGCCTGGTACTCACCTTGTGTGTCCCTGGGACGTAGGAAGAGTGCAGCCGGCTACAACCTCACGGGGCTCTTCGTGGGCTCCGAGGGGACGCTGGGCCTCATCACAGCCACCACCCTGCGCCTGCACCCTGCCCCTGAGGCCACAGTGGCCGCCACGTGTGCGTTCCCCAGTGTCCAGGCTGCTGTGGACAGCACTGTACACATCCTCCAGGCTGCAGTGCCCGTAGCCCGCATTGAGTTCCTGGATGAAGTCATGATGGATGCCTGCAACAGGTACAGCAAGCTGAATTGCTTAGTGGCGCCCACACTCTTCCTGGAGTTCCATGGCTCCCAGCAGGCACTGGAGGAGCAGCTGCAGCGCACAGAGGAGATAGTCCAGCAGAACGGAGCCTCTGACTTCTCCTGGGCCAAGGAGGCCGAGGAGCGCAGCCGGCTTTGGACAGCACGGCACAATGCCTGGTACGCAGCCCTGGCCACGCGGCCAGGCTGCAAGGGCTACTCCACGGATGTGTGTGTGCCCATCTCCCGGCTGCCGGAGATCGTGGTGCAGACCAAGGAGGATCTGAATGCCTCAGGACTCACAGGAAGCATTGTCGGGCATGTGGGTGACGGCAACTTCCACTGCATCCTGCTGGTCAACCCTGATGACGCCGAGGAACTGGGCAGGGTCAAGGCTTTTGCAGAACAGCTGGGCAGGCGGGCACTGGCTCTCCACGGAACGTGCACGGGGGAGCATGGCATCGGAATGGGCAAGCGGCAGCTGCTGCAGGAGGAGGTGGGCGCCGTGGGCGTGGAGACCATGCGGCAGCTCAAGGCCGTGCTAGACCCCCAAGGCCTCATGAATCCAGGCAAAGTGCTGTGA

Length: 1524

View AllClose

0 Reviews

View AllClose