Human LDHAL6B cDNA Clone BC022034 pENTR223.1 or pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL863163HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
LDHAL6B
Gene ID:
92483
Accession #:
BC022034
Plasmid:
Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
€214.00
Frequently bought together:

Description

Human LDHAL6B cDNA Clone BC022034 pENTR223.1 or pUC Plasmid | Cusabio

Gene Name: LDHAL6B

Gene ID: 92483

Accession Number: BC022034

Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGAGTTGGACTGTGCCTGTTGTGCGGGCCAGCCAGAGAATGAGCTCGGTGGGAGCGAATTTCCTATGCCTGGGGATGGCCCTGTGTCTGCGTCAAGCAACGCGCATCCCGCTCAACGGCACCTGGCTCTTCACACCCGTGAGCAAGATGGCGACTGTGAAGAGTGAGCTTATTGAGCGTTTCACTTCCGAGAAGCCCGTTCATCACAGTAAGGTCTCCATCATAGGAACTGGATCGGTGGGCATGGCCTGCGCTATCAGCATCTTATTAAAAGGCTTGAGTGATGAACTTGCCCTTGTGGATCTTGATGAAGACAAACTGAAGGGTGAGACGATGGATCTTCAACATGGCAGCCCTTTCACGAAAATGCCAAATATTGTTTGTAGCAAAGATTACTTTGTCACAGCAAACTCCAACCTAGTGATTATCACAGCAGGTGCACGCCAAGAAAAGGGAGAAACGCGCCTTAATTTAGTCCAGCGAAATGTGGCCATCTTCAAGTTAATGATTTCCAGTATTGTCCAGTACAGCCCCCACTGCAAACTGATTATTGTTTCCAATCCAGTGGATATCTTAACTTATGTAGCTTGGAAGTTGAGTGCATTTCCCAAAAACCGTATTATTGGAAGCGGCTGTAATCTGGATACTGCTCGTTTTCGTTTCTTGATTGGACAAAAGCTTGGTATCCATTCTGAAAGCTGCCATGGATGGATCCTCGGAGAGCATGGAGACTCAAGTGTTCCTGTGTGGAGTGGAGTGAACATAGCTGGTGTCCCTTTGAAGGATCTGAACTCTGATATAGGAACTGATAAAGATCCTGAGCAATGGAAAAATGTCCACAAAGAAGTGACTGCAACTGCCTATGAGATTATTAAAATGAAAGGTTATACTTCTTGGGCCATTGGCCTATCTGTGGCCGATTTAACAGAAAGTATTTTGAAGAATCTTAGGAGAATACATCCAGTTTCCACCATAACTAAGGGCCTCTATGGAATAGATGAAGAAGTATTCCTCAGTATTCCTTGTATCCTGGGAGAGAACGGTATTACCAACCTTATAAAGATAAAGCTGACCCCTGAAGAAGAGGCCCATCTGAAAAAAAGTGCAAAAACACTCTGGGAAATTCAGAATAAGCTTAAGCTTTAA

Length: 1146

View AllClose

0 Reviews

View AllClose