Human LDHAL6A cDNA Clone BC014340 pENTR223.1 or pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL741047HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
LDHAL6A
Gene ID:
160287
Accession #:
BC014340
Plasmid:
Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
€214.00
Frequently bought together:

Description

Human LDHAL6A cDNA Clone BC014340 pENTR223.1 or pUC Plasmid | Cusabio

Gene Name: LDHAL6A

Gene ID: 160287

Accession Number: BC014340

Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGGCAACTATCAAGAGTGAACTTATTAAGAATTTCGCGGAAGAGGAGGCCATTCATCACAATAAGATCTCCATTGTAGGAACTGGATCGGTTGGTGTGGCTTGTGCTATCAGCATCTTATTAAAAGGTTTGAGTGATGAACTTGTCCTTGTGGATGTTGATGAAGGCAAACTGAAGGGTGAGACAATGGATCTTCAACATGGCAGCCCTTTTATGAAAATGCCAAATATTGTCTCCAGCAAAGATTACCTGGTCACTGCAAACTCCAATCTAGTGATTATCACAGCAGGTGCACGCCAGAAAAAAGGAGAAACACGCCTTGATTTAGTCCAGCGAAATGTATCCATCTTTAAATTAATGATTCCGAATATTACCCAGTACAGTCCTCACTGCAAACTGCTTATTGTTACTAATCCAGTGGATATCTTAACTTATGTAGCCTGGAAGTTGAGTGGATTTCCCAAAAACCGTGTTATTGGAAGTGGTTGTAATCTGGACTCTGCTCGTTTTCGTTACTTTATTGGGCAAAGGCTTGGCATCCACTCTGAAAGCTGTCATGGGCTGATCCTTGGAGAGCATGGCGACTCAAGTGTTCCTGTGTGGAGTGGTGTGAACATTGCTGGCGTCCCTCTGAAGGATCTGAACCCAGATATAGGAACTGATAAGGATCCTGAGCAGTGGGAAAATGTCCACAAAAAAAAGTGA

Length: 705

View AllClose

0 Reviews

View AllClose