Human LDB3 cDNA Clone BC010929 pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL012831HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
LDB3
Gene ID:
11155
Accession #:
BC010929
Plasmid:
pUC
€321.00
Frequently bought together:

Description

Human LDB3 cDNA Clone BC010929 pUC Plasmid | Cusabio

Gene Name: LDB3

Gene ID: 11155

Accession Number: BC010929

Vector: pUC

Sequence: ATGTCTTACAGTGTGACCCTGACTGGGCCCGGGCCCTGGGGCTTCCGTCTGCAGGGGGGCAAGGACTTCAACATGCCCCTCACTATCTCCCGGATCACACCAGGCAGCAAGGCAGCCCAGTCCCAGCTCAGCCAGGGTGACCTCGTGGTGGCCATTGACGGCGTCAACACAGACACCATGACCCACCTGGAAGCCCAGAACAAGATCAAGTCTGCCAGCTACAACTTGAGCCTCACCCTGCAGAAATCAAAGCGTCCCATTCCCATCTCCACGACAGCACCTCCAGTCCAGACCCCTCTGCCGGTGATCCCTCACCAGAAGGTGGTAGTCAACTCTCCAGCCAACGCCGACTACCAGGAACGCTTCAACCCCAGTGCCCTGAAGGACTCGGCCCTGTCCACCCACAAGCCCATCGAGGTGAAGGGGCTGGGCGGCAAGGCCACCATCATCCATGCGCAGTACAACACGCCCATCAGCATGTATTCCCAGGATGCCATCATGGATGCCATCGCTGGGCAGGCCCAAGCCCAAGGCAGTGACTTCAGTGGGAGCCTCCCTATTAAGGACCTTGCCGTAGACAGCGCCTCCCCCGTCTACCAGGCTGTGATTAAGAGCCAGAACAAGCCAGAAGATGAGGCTGACGAGTGGGCACGCCGTTCCTCCAACCTGCAGTCTCGCTCCTTCCGCATCCTGGCCCAGATGACGGGGACAGAATTCATGCAAGACCCTGATGAAGAAGCTCTGCGAAGGTCAAGGGAAAGGTTTGAAACGGAACGTAACAGCCCACGTTTTGCCAAATTGCGCAACTGGCACCATGGCCTTTCAGCCCAAATCCTTAATGTTAAAAGCTAA

Length: 852

View AllClose

0 Reviews

View AllClose