Human LDB1 cDNA Clone BC000482 pENTR223.1 or pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL771433HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
LDB1
Gene ID:
8861
Accession #:
BC000482
Plasmid:
Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
£171.20
Frequently bought together:

Description

Human LDB1 cDNA Clone BC000482 pENTR223.1 or pUC Plasmid | Cusabio

Gene Name: LDB1

Gene ID: 8861

Accession Number: BC000482

Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGCTGGATAGGGATGTGGGCCCAACTCCCATGTATCCGCCTACATACCTGGAGCCAGGGATTGGGAGGCACACACCATATGGCAACCAAACTGACTACAGAATATTTGAGCTTAACAAACGGCTTCAGAACTGGACAGAGGAGTGTGACAATCTCTGGTGGGATGCATTCACGACTGAGTTCTTTGAGGATGATGCCATGTTGACCATCACTTTCTGCCTGGAGGATGGACCAAAGAGATATACCATTGGCCGGACCCTGATCCCACGCTACTTCCGCAGCATCTTTGAGGGGGGTGCTACGGAGCTGTACTATGTTCTTAAGCACCCCAAGGAGGCATTCCACAGCAACTTTGTGTCCCTCGACTGTGACCAGGGCAGCATGGTGACCCAGCATGGCAAGCCCATGTTCACCCAGGTGTGTGTGGAGGGCCGGTTGTACCTGGAGTTCATGTTTGACGACATGATGCGGATAAAGACGTGGCACTTCAGCATCCGGCAGCACCGAGAGCTCATCCCCCGCAGCATCCTTGCCATGCATGCCCAAGACCCCCAGATGTTGGATCAGCTCTCCAAAAACATCACTCGGTGTGGGCTGTCCAATTCCACTCTCAACTACCTCCGACTCTGTGTGATACTCGAGCCCATGCAAGAGCTCATGTCACGCCACAAGACCTACAGCCTCAGCCCCCGCGACTGCCTCAAGACCTGCCTTTTCCAGAAGTGGCAGCGCATGGTAGCACCCCCTGCGGAGCCCACACGTCAGCAGCCCAGCAAACGGCGGAAACGGAAGATGTCAGGGGGCAGCACCATGAGCTCTGGTGGTGGCAACACCAACAACAGCAACAGCAAGAAGAAGAGCCCAGCTAGCACCTTCGCCCTCTCCAGCCAGGTACCTGATGTGATGGTGGTGGGGGAGCCCACCCTGATGGGCGGGGAGTTCGGGGACGAGGACGAGAGGCTCATCACCCGGCTGGAGAACACCCAGTTTGACGCAGCCAACGGCATTGACGACGAGGACAGCTTTAACAACTCCCCTGCACTGGGCGCCAACAGCCCCTGGAACAGCAAGCCTCCGTCCAGCCAAGAAAGCAAATCGGAGAACCCCACGTCACAGGCCTCCCAGTAA

Length: 1128

View AllClose

0 Reviews

View AllClose