Human LCP2 cDNA Clone BC016618 pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL622635HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
LCP2
Gene ID:
3937
Accession #:
BC016618
Plasmid:
pUC
€516.00
Frequently bought together:

Description

Human LCP2 cDNA Clone BC016618 pUC Plasmid | Cusabio

Gene Name: LCP2

Gene ID: 3937

Accession Number: BC016618

Vector: pUC

Sequence: ATGGCACTGAGGAATGTGCCCTTTCGCTCAGAGGTCCTGGGCTGGGACCCCGACAGCCTTGCTGACTATTTCAAGAAGCTCAACTATAAGGACTGTGAGAAGGCAGTGAAGAAGTACCACATCGATGGGGCTCGCTTCTTGAACCTGACAGAAAATGACATCCAGAAGTTCCCCAAGCTCCGGGTGCCGATTCTCAGTAAGTTAAGTCAGGAAATCAACAAGAACGAAGAGAGGAGGAGCATCTTCACACGCAAACCCCAAGTCCCGCGGTTTCCTGAAGAGACAGAAAGCCACGAAGAGGACAATGGGGGCTGGTCGTCCTTTGAAGAAGACGATTATGAAAGTCCCAATGATGACCAGGATGGGGAGGATGATGGAGACTATGAGTCCCCCAATGAGGAGGAAGAGGCACCCGTGGAAGATGACGCGGATTATGAGCCGCCACCCTCCAATGACGAGGAAGCTCTGCAGAACTCCATCCTGCCTGCCAAGCCTTTCCCCAACTCCAACTCCATGTACATCGACCGGCCCCCCTCTGGGAAAACCCCCCAGCAGCCTCCTGTGCCCCCCCAGAGACCGATGGCCGCCCTCCCGCCCCCACCAGCCGGCCGGAATCACTCGCCACTGCCCCCACCCCAGACCAACCACGAAGAACCCAGCAGAAGCAGAAACCACAAAACGGCAAAGCTCCCTGCTCCTTCAATAGACAGAAGCACGAAACCTCCCCTAGATCGTTCATTAGCTCCGTTTGATAGAGAACCCTTCACACTAGGAAAGAAACCACCATTTTCTGACAAGCCCTCGATTCCAGCGGGAAGGTCACTCGGGGAGCATTTACCCAAGATTCAAAAGCCTCCTTTACCACCGACCACGGAAAGACATGAAAGGAGCAGCCCCCTGCCAGGGAAGAAGCCACCTGTGCCAAAGCATGGATGGGGACCAGACAGAAGAGAGAATGATGAAGATGATGTGCATCAGAGACCTTTGCCCCAGCCAGCACTACTTCCTATGAGCTCCAACACTTTCCCTTCAAGATCTACTAAGCCAAGTCCCATGAACCCTCTCCCATCCTCTCACATGCCTGGAGCATTCTCAGAAAGTAACAGCAGTTTTCCACAGAGTGCCTCCCTGCCACCATACTTCTCTCAAGGCCCTAGCAACAGACCACCTATCAGAGCCGAAGGCAGAAACTTCCCCTTGCCACTTCCAAACAAACCTCGGCCCCCATCCCCCGCGGAGGAAGAGAATTCATTAAATGAAGAGTGGTACGTTTCTTATATTACCCGACCAGAGGCAGAAGCTGCTCTTAGAAAGATAAACCAGGATGGCACATTTCTGGTCAGAGACAGCTCTAAAAAAACAACAACCAATCCATATGTCCTCATGGTGTTGTACAAAGATAAAGTTTACAACATCCAGATCCGTTATCAGAAGGAAAGTCAAGTTTACTTGTTGGGAACTGGACTCCGAGGGAAAGAGGACTTTCTGTCTGTGTCAGATATTATTGACTACTTCAGGAAAATGCCACTTCTGCTCATTGATGGGAAAAACCGAGGTTCCAGATACCAGTGCACATTAACGCATGCTGCAGGGTACCCATAG

Length: 1602

View AllClose

0 Reviews

View AllClose