Human LCORL cDNA Clone BC037322 pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL836658HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
LCORL
Gene ID:
254251
Accession #:
BC037322
Plasmid:
pUC
€348.00
Frequently bought together:

Description

Human LCORL cDNA Clone BC037322 pUC Plasmid | Cusabio

Gene Name: LCORL

Gene ID: 254251

Accession Number: BC037322

Vector: pUC

Sequence: ATGGACAAGGGAAGAGAGAGAATGGCCGCTGCCGCCGCCGCTGCTGCCGCCGCCGCCGCCGCCGCTCAGTGCCGGAGCCCTCGGTGCGCGGCGGAGAGAAGAGGATTCCGGCGGGAACTCGACTCTTGGCGCCACCGCCTCATGCACTGTGTAGGTTTTGAGAGTATTTTAGAAGGGCTTTATGGACCACGGCTACGAAGAGACCTCAGTTTATTTGAAGACTGTGAACCAGAAGAGCTGACTGACTGGTCTATGGATGAAAAATGTTCATTTTGTAACCTACAGAGAGAAGCAGTCAGTGATTGTATACCATCTCTTGATTCTTCACAGTCAACACCAACAGAGGAGCTATCATCTCAGGGCCAGTCCAACACTGATAAGATTGAATGCCAAGCAGAAAATTACCTAAATGCACTCTTTCGAAAGAAAGATCTTCCTCAGAACTGTGATCCTAACATTCCCCTAGTTGCTCAGGAATTAATGAAAAAGATGATACGTCAATTTGCGATTGAGTACATTTCAAAAAGTGGTAAAACTCAAGAGAATAGAAATGGTTCAATTGGACCAAGTATAGTATGTAAAAGTATCCAAATGAATCAAGCAGAAAACTCCCTTCAGGAAGAGCAGGAAGGCCCCTTAGACCTCACTGTGAATCGAATGCAAGAACAAAATACTCAGCAAGGGGATGGAGTGTTAGATCTCTCTACAAAGAAAACCAGCATAAAATCTGAAGAGTCATCCATATGTGATCCTTCTTCTGAAAATTCAGTGGCTGGCATGCTACAAGTGAAAACTGATGAGAAACTGAATGTGTCTGATGAGAATACAGCAAGTTGCCCTTTGAGCCCCATTAAGATGTGCCTTAATCGTCCCATTGAATGGAATCTGAATTTGACAACAGCATCTCTAACGAGCTGTACAGTTCATAACCAAAATCTCAAAAGCGAAGAGAAATAG

Length: 957

View AllClose

0 Reviews

View AllClose