Human LCOR cDNA Clone BC053359 pENTR223.1 or pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL856960HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
LCOR
Gene ID:
84458
Accession #:
BC053359
Plasmid:
Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
€214.00
Frequently bought together:

Description

Human LCOR cDNA Clone BC053359 pENTR223.1 or pUC Plasmid | Cusabio

Gene Name: LCOR

Gene ID: 84458

Accession Number: BC053359

Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGCAGCGAATGATCCAACAATTTGCTGCTGAATATACCTCAAAAAATAGCTCTACTCAGGACCCCAGCCAGCCCAATAGCACAAAGAACCAAAGCCTGCCGAAAGCATCTCCAGTCACCACCTCTCCCACGGCTGCAACTACTCAGAACCCTGTGCTCAGCAAACTTCTCATGGCTGACCAAGACTCACCTCTGGACCTTACTGTCAGAAAGTCTCAGTCAGAACCTAGCGAACAAGACGGTGTACTTGATCTGTCCACTAAGAAAAGTCCATGTGCTGGCAGCACTTCCCTGAGCCACTCTCCAGGCTGCTCCAGTACTCAAGGGAACGGGCGACCTGGGAGACCCAGCCAGTACCGCCCAGACGGACTTCGGAGTGGTGATGGGGTACCTCCAAGAAGCTTACAGGATGGAACCAGGGAAGGTTTTGGACACTCCACATCACTCAAAGTTCCACTGGCTCGATCCCTGCAGATTAGTGAAGAACTACTGAGCAGAAACCAATTGTCCACAGCTGCCAGCCTTGGGCCATCTGGATTACAGAATCATGGACAACACTTAATATTATCCAGGGAAGCCTCTTGGGCAAAACCACATTACGAGTTCAACCTCAGCCGTATGAAGTTCAGGGGAAATGGTGCACTCAGCAACATCAGTGACCTTCCTTTTCTTGCAGAAAACTCTGCCTTTCCAAAAATGGCACTTCAAGCAAAACAAGATGGAAAAAAGGATGTGAGCCATTCATCTCCTGTAGATTTAAAGATACCACAAGTTCGAGGAATGGATCTTTCTTGGGAGTCTCGCACTGGTGATCAGTACAGCTATAGCTCTTTGGTAATGGGTTCACAAACGGAGAGCGCGCTTAGTAAAAAATTAAGGGCTATTCTTCCAAAACAAAGTAGAAAAAGCATGTTAGATGCTGGACCCGATTCTTGGGGCTCAGATGCTGAGCAGTCTACCTCTGGACAGCCATATCCCACATCGGATCAAGAAGGAGACCCTGGCTCCAAGCAGCCTCGGAAGAAAAGAGGGCGTTACAGACAGTACAACAGTGAGATACTGGAGGAAGCAATCTCAGTGGTTATGAGTGGAAAAATGAGTGTTTCCAAAGCTCAGAGTATTTATGGGATTCCCCACAGTACACTGGAGTACAAAGTAAAGGAGAGGCTGGGCACTTTGAAAAACCCTCCAAAGAAAAAGATGAAATTAATGAGTGGATGA

Length: 1221

View AllClose

0 Reviews

View AllClose