Human LCN8 cDNA Clone BC130465 pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL750369HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
LCN8
Gene ID:
138307
Accession #:
BC130465
Plasmid:
pUC
€219.00
Frequently bought together:

Description

Human LCN8 cDNA Clone BC130465 pUC Plasmid | Cusabio

Gene Name: LCN8

Gene ID: 138307

Accession Number: BC130465

Vector: pUC

Sequence: ATGGAGGAGCTGGACCGGCAGAAGATTGGAGGATTCTGGAGGGAAGTCGGTGTGGCCTCCGATCAAAGCCTGGTGCTGACGGCCCCGAAGCGGGTGGAGGGCTTGTTCCTCACCTTGAGCGGGAGTAACCTGACCGTGAAGGTTGCATATAACAGCTCAGGAAGCTGTGAGATAGAGAAGATCGTGGGCTCAGAAATAGACAGTACGGGAAAATTCGCTTTTCCTGGCCACAGAGAGATCCACGTGCTGGACACCGACTACGAGGGCTACGCCATCCTGCGGGTGTCCCTGATGTGGCGGGGCAGGAACTTTCGCGTCCTCAAGTACTTTACTCGGAGCCTTGAGGACAAGGACCGGCTGGGGTTCTGGAAGTTTCGGGAGCTGACAGCAGACACTGGTCTCTACCTGGCGGCCCGGCCTGGGCGGTGTGCCGAGCTCCTGAAGGAGGAGCTGATTTAA

Length: 459

View AllClose

0 Reviews

View AllClose