Human LCN6 cDNA Clone BC062746 pENTR223.1 Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL012817HU
Availability:
3 to 5 Working Days
Size:
10 μg plasmid + 200μl Glycerol
Gene:
LCN6
Gene ID:
158062
Accession #:
BC062746
Plasmid:
pENTR223.1
$256.80
Frequently bought together:

Description

Human LCN6 cDNA Clone BC062746 pENTR223.1 Plasmid | Cusabio

Gene Name: LCN6

Gene ID: 158062

Accession Number: BC062746

Vector: pENTR223.1

Sequence: ATGGGCGGCCTGCTGCTGGCTGCTTTTCTGGCTTTGGTCTCGGTGCCCAGGGCCCAGGCCGTGTGGTTGGGAAGACTGGACCCTGAGCAGCTTCTTGGGCCCTGGTACGTGCTTGCGGTGGCCTCCCGGGAAAAGGGCTTTGCCATGGAGAAGGACATGAAGAACGTCGTGGGGGTGGTGGTGACCCTCACTCCAGAAAACAACCTGCGGACGCTGTCCTCTCAGCACGGGCTGGGAGGGTGTGACCAGAGTGTCATGGACCTGATAAAGCGAAACTCCGGATGGGTGTTTGAGAATCCCTCAATAGGCGTGCTGGAGCTCTGGGTGCTGGCCACCAACTTCAGAGACTATGCCATCATCTTCACTCAGCTGGAGTTCGGGGACGAGCCCTTCAACACCGTGGAGCTGTACAGTCTGACTGAGACAGCCAGCCAGGAGGCCATGGGGCTCTTCACCAAGTGGAGCAGGAGCCTGGGCTTCCTGTCACAGTAG

Length: 492

View AllClose

0 Reviews

View AllClose