Human LCMT1 cDNA Clone BC001214 pENTR223.1 or pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL012808HU2
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
LCMT1
Gene ID:
51451
Accession #:
BC001214
Plasmid:
Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
£171.20
Frequently bought together:

Description

Human LCMT1 cDNA Clone BC001214 pENTR223.1 or pUC Plasmid | Cusabio

Gene Name: LCMT1

Gene ID: 51451

Accession Number: BC001214

Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGGCCACTAGGCAGAGGGAATCCTCTATCACCTCCTGCTGTTCCACCTCGAGCTGCGACGCAGACGACGAGGGCGTGCGCGGCACCTGCGAAGATGCTTCCCTGTGCAAGAGGTTTGCAGTAAGCATTGGCTACTGGCATGACCCTTACATACAGCACTTTGTGAGACTGTCTAAAGAGAGGAAAGCCCCTGAAATCAACAGAGGATATTTTGCTCGAGTCCATGGTGTCAGTCAGCTTATAAAGGCATTTCTACGGAAGACAGAATGTCATTGTCAAATTGTCAACCTTGGGGCAGGCATGGATACCACCTTCTGGAGATTAAAGGATGAAGATCTTCTCCCAAGTAAATATTTTGAGGTTGACTTTCCAATGATTGTCACGAGAAAGCTGCACAGTATCAAATGCAAGCCTCCCCTATCCAGCCCCATTCTAGAACTGCATTCAGAGGACACACTTCAGATGGATGGACACATACTGGATTCAAAGAGATATGCCGTTATTGGAGCAGATCTCCGAGACCTGTCTGAACTGGAAGAGAAGCTAAAGAAATGTAACATGAATACACAATTGCCAACACTCCTGATAGCTGAATGTGTGCTGGTTTACATGACTCCAGAGCAGTCCGCAAACCTCCTGAAGTGGGCAGCCAACAGTTTTGAGAGAGCCATGTTCATAAACTACGAACAGGTGAACATGGGTGATCGGTTTGGGCAGATCATGATTGAAAACCTGCGGAGACGCCAGTGTGACCTGGCGGGAGTGGAGACCTGCAAGTCATTAGAGTCACAGAAAGAACGGCTCCTGTCGAATGGGTGGGAAACAGCATCGGCCGTCGACATGATGGAGTTGTACAACAGGTTACCTCGAGCTGAAGTGAGCAGGATAGAATCACTTGAATTCCTGGATGAAATGGAGCTGCTGGAGCAGCTCATGCGGCATTACTGCCTTTGCTGGGCAACCAAAGGAGGAAATGAGCTTGGGCTGAAGGAGATAACTTATTAA

Length: 1005

View AllClose

0 Reviews

View AllClose