Human LCK cDNA Clone BC013200 pENTR223.1 Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL012806HU
Availability:
3 to 5 Working Days
Size:
10 μg plasmid + 200μl Glycerol
Gene:
LCK
Gene ID:
3932
Accession #:
BC013200
Plasmid:
pENTR223.1
€214.00
Frequently bought together:

Description

Human LCK cDNA Clone BC013200 pENTR223.1 Plasmid | Cusabio

Gene Name: LCK

Gene ID: 3932

Accession Number: BC013200

Vector: pENTR223.1

Sequence: ATGGGCTGTGGCTGCAGCTCACACCCGGAAGATGACTGGATGGAAAACATCGATGTGTGTGAGAACTGCCATTATCCCATAGTCCCACTGGATGGCAAGGGCACGCTGCTCATCCGAAATGGCTCTGAGGTGCGGGACCCACTGGTTACCTACGAAGGCTCCAATCCGCCGGCTTCCCCACTGCAAGACAACCTGGTTATCGCTCTGCACAGCTATGAGCCCTCTCACGACGGAGATCTGGGCTTTGAGAAGGGGGAACAGCTCCGCATCCTGGAGCAGAGCGGCGAGTGGTGGAAGGCGCAGTCCCTGACCACGGGCCAGGAAGGCTTCATCCCCTTCAATTTTGTGGCCAAAGCGAACAGCCTGGAGCCCGAACCCTGGTTCTTCAAGAACCTGAGCCGCAAGGACGCGGAGCGGCAGCTCCTGGCGCCCGGGAACACTCACGGCTCCTTCCTCATCCGGGAGAGCGAGAGCACCGCGGGATCGTTTTCACTGTCGGTCCGGGACTTCGACCAGAACCAGGGAGAGGTGGTGAAACATTACAAGATCCGTAATCTGGACAACGGTGGCTTCTACATCTCCCCTCGAATCACTTTTCCCGGCCTGCATGAACTGGTCCGCCATTACACCAATGCTTCAGATGGGCTGTGCACACGGTTGAGCCGCCCCTGCCAGACCCAGAAGCCCCAGAAGCCGTGGTGGGAGGACGAGTGGGAGGTTCCCAGGGAGACGCTGAAGCTGGTGGAGCGGCTGGGGGCTGGACAGTTCGGGGAGGTGTGGATGGGGTACTACAACGGGCACACGAAGGTGGCGGTGAAGAGCCTGAAGCAGGGCAGCATGTCCCCGGACGCCTTCCTGGCCGAGGCCAACCTCATGAAGCAGCTGCAACACCAGCGGCTGGTTCGGCTCTACGCTGTGGTCACCCAGGAGCCCATCTACATCATCACTGAATACATGGAGAATGACACACTTCTAGACTCCCAGTTGGAGGAGAAAGGTCTGGGGGCCTCCCCCTGGGGCAACTTGGGCCAGCAACTCTTGCTTCTGCCCACAGGGAGTCTAGTGGATTTTCTCAAGACCCCTTCAGGCATCAAGTTGACCATCAACAAACTCCTGGACATGGCAGCCCAAATTGCAGAAGGCATGGCATTCATTGAAGAGCGGAATTATATTCATCGTGACCTTCGGGCTGCCAACATTCTGGTGTCTGACACCCTGAGCTGCAAGATTGCAGACTTTGGCCTAGCACGCCTCATTGAGGACAACGAGTACACAGCCAGGGAGGGGGCCAAGTTTCCCATTAAGTGGACAGCGCCAGAAGCCATTAACTACGGGACATTCACCATCAAGTCAGATGTGTGGTCTTTTGGGATCCTGCTGACGGAAATTGTCACCCACGGCCGCATCCCTTACCCAGGGATGACCAACCCGGAGGTGATTCAGAACCTGGAGCGAGGCTACCGCATGGTGCGCCCTGACAACTGTCCAGAGGAGCTGTACCAACTCATGAGGCTGTGCTGGAAGGAGCGCCCAGAGGACCGGCCCACCTTTGACTACCTGCGCAGTGTGCTGGAGGACTTCTTCACGGCCACAGAGGGCCAGTACCAGCCTCAGCCTTGA

Length: 1620

View AllClose

0 Reviews

View AllClose