null

Human LCE3C cDNA Clone BC130365 pENTR223.1 or pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL725885HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
LCE3C
Gene ID:
353144
Accession #:
BC130365
Plasmid:
Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
€214.00
Frequently bought together:

Description

Human LCE3C cDNA Clone BC130365 pENTR223.1 or pUC Plasmid | Cusabio

Gene Name: LCE3C

Gene ID: 353144

Accession Number: BC130365

Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGTCCTGCCAGCAAAACCAGCAGCAGTGCCAGCCCCCTCCCAGTTGTCCCTCACCCAAGTGTCCCCCAAAGAGCCCAGCACAGTGTCTGCCTCCACCCTCTTCTGACTGTGCTCTAAGCTCCGGGGGCTGTGGCCCCAGTTCTGAAAGTGGCTGCTGCCTGAGCCACCACAGGCACTTCAGGTCCCATCAATGCCGGCGCCAGAGATCCAACTCCTGTGACAGGGGCAGTGGTCAGCAAGGCGGGGGCTCCTGCCGTGGCCATGGCTCTGGGGGCTGCTGCTGA

Length: 285

View AllClose

0 Reviews

View AllClose