Human LCE1B cDNA Clone BC104232 pENTR223.1 or pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL732929HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
LCE1B
Gene ID:
353132
Accession #:
BC104232
Plasmid:
Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
£171.20
Frequently bought together:

Description

Human LCE1B cDNA Clone BC104232 pENTR223.1 or pUC Plasmid | Cusabio

Gene Name: LCE1B

Gene ID: 353132

Accession Number: BC104232

Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGTCCTGCCAGCAGAACCAGCAGCAGTGCCAGCCCCCTCCCAAGTGCATCCCCAAGTGCCCTCCCAAGTGCCTCACCCCTAGATGCCCCCCAAAGTGTCCCCCTAAGTGTCCTCCAGTCTCTTCCTGCTGCAGTGTCAGCTCCGGAGGCTGCTGTGGCTCCAGCTCTGGGGGAAGCTGTGGCTCCAGCTCTGGGGGTTGCTGCAGTTCTGGGGGAGGTGGCTGCTGCCTGAGCCACCACAGGCGCCGTAGGTCCCACTGCCACAGACCCCAGAGCTCTGGCTGCTGCAGCCAGCCCTCCGGGGGCTCCAGCTGCTGTGGAGGAGGGAGTGGCCAGCACTCTGGAGGCTGCTGCTAA

Length: 357

View AllClose

0 Reviews

View AllClose