Human LCA5L cDNA Clone BC031059 pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL012782HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
LCA5L
Gene ID:
150082
Accession #:
BC031059
Plasmid:
pUC
€623.00
Frequently bought together:

Description

Human LCA5L cDNA Clone BC031059 pUC Plasmid | Cusabio

Gene Name: LCA5L

Gene ID: 150082

Accession Number: BC031059

Vector: pUC

Sequence: ATGTCTTTGGCTGATCTAACAAAAACAAATATAGATGAGCATTTCTTCGGCGTGGCATTAGAAAACAATAGGAGGTCTGCAGCATGCAAGAGAAGCCCAGGCACAGGCGATTTTTCACGGAACAGTAATGCTTCCAATAAGAGTGTTGATTATAGCAGATCTCAGTGCTCCTGTGGAAGTTTAAGTTCTCAGTATGATTATTCAGAAGACTTTCTCTGTGATTGTTCAGAAAAGGCTATTAATAGAAATTATTTAAAGCAGCCTGTGGTAAAAGAAAAGGAGAAGAAAAAGTATAATGTTTCTAAAATCTCCCAATCTAAAGGCCAGAAGGAAATATCAGTTGAAAAAAAGCACACCTGGAATGCATCACTCTTTAATTCTCAAATCCATATGATTGCCCAAAGAAGAGATGCTATGGCTCATCGAATACTCTCAGCAAGGCTTCATAAAATTAAAGGACTAAAAAATGAATTAGCTGATATGCATCATAAATTGGAAGCCATCCTTACAGAAAACCAATTTTTGAAACAACTTCAGCTTAGGCATTTGAAAGCTATAGGAAAATATGAGAATTCACAAAATAATCTACCTCAAATTATGGCTAAACATCAGAATGAAGTAAAAAATTTAAGGCAACTACTTAGGAAATCCCAGGAAAAGGAAAGAACTCTATCTAGGAAACTTAGAGAAACTGACAGCCAGTTACTGAAGACTAAAGATATCTTGCAGGCACTGCAGAAACTTTCTGAAGACAAAAACCTTGCAGAAAGGGAAGAACTCACTCATAAATTATCTATTATCACAACAAAAATGGACGCAAATGACAAAAAAATACAGAGCTTGGAAAAACAACTGAGGTTGAACTGCAGAGCCTTTAGCCGGCAGCTGGCTATTGAGACTCGGAAGACTTTAGCAGCTCAGACAGCTACCAAGACTCTGCAGGTGGAAGTAAAACACCTTCAACAAAAACTTAAGGAAAAGGATCGTGAGCTTGAAATTAAAAACATCTATAGTCATCGAATACTTAAAAATTTACATGACACAGAGGACTATCCAAAAGTTTCTTCAACAAAATCAGTCCAAGCAGACAGAAAAATTTTGCCATTCACAAGTATGAGACACCAGGGAACCCAAAAATCAGATGTTCCACCTTTGACAACTAAGGGTAAAAAGGCAACAGGAAACATCGATCATAAAGAAAAATCAACTGAAATAAATCATGAAATTCCTCACTGTGTGAATAAACTACCAAAGCAAGAGGATTCTAAGAGAAAATATGAAGATTTATCAGGGGAAGAGAAACATTTGGAAGTCCAAATACTGCTGGAGAATACTGGAAGACAAAAAGACAAAAAAGAAGACCAAGAAAAGAAAAACATTTTTGTGAAAGAAGAGCAAGAACTACCACCAAAAATAATTGAAGTTATTCATCCTGAAAGAGAAAGCAATCAAGAAGATGTTCTAGTAAGAGAAAAGTTTAAAAGAAGCATGCAGAGAAATGGTGTGGATGACACACTTGGCAAAGGCACTGCTCCCTACACGAAAGGCCCCCTCAGACAAAGAAGACATTACTCATTCACAGAAGCAACTGAAAACCTGCATCATGGGCTTCCTGCTTCAGGGGGGCCAGCCAATGCCGGCAACATGAGGTACAGTCATAGTACAGGCAAGCATCTCAGTAACAGAGAGGAAATGGAGCTAGAGCATTCTGACAGTGGGTATGAGCCCTCATTTGGTAAGTCTTCCAGAATAAAAGTGAAGGATACAACTTTCAGAGATAAGAAAAGCAGTCTCATGGAAGAACTCTTTGGATCAGGCTATGTCTTGAAAACTGACCAATCAAGTCCTGGTGTTGCAAAAGGCTCAGAGGAGCCTTTGCAAAGTAAGGAGTCGCATCCCCTGCCTCCCAGTCAGGCCTCCACCAGCCATGCTTTCGGAGACTCTAAAGTAACTGTGGTAAATTCTATTAAGCCATCGTCACCTACAGAAGGAAAAAGAAAAATAATTATTTAA

Length: 2013

View AllClose

0 Reviews

View AllClose