Human LCA5 cDNA Clone BC050327 pENTR223.1 or pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL769789HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
LCA5
Gene ID:
167691
Accession #:
BC050327
Plasmid:
Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
€438.00
Frequently bought together:

Description

Human LCA5 cDNA Clone BC050327 pENTR223.1 or pUC Plasmid | Cusabio

Gene Name: LCA5

Gene ID: 167691

Accession Number: BC050327

Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGGGGGAAAGAGCAGGAAGTCCAGGTACTGATCAAGAAAGAGAGGCAGGCAAACACCATTATTCTTACTCATCTGATTTTGAAACGCCACAGTCTTCTGGCCGATCATCGCTGGTCAGTTCTTCACCTGCAAGTGTTAGGAGAAAAAATCCTAAAAGACAAACTTCAGATGGCCAAGTACATCACCAAGCCCCTCGGAAACCAAGCCCTAAGGGTCTACCAAACAGAAAGGGAGTCCGAGTGGGATTTCGCTCCCAGAGCCTCAATAGAGAGCCACTTCGGAAAGATACTGATCTTGTTACAAAACGGATTCTGTCTGCAAGACTGCTAAAAATCAATGAGTTGCAGAATGAAGTATCTGAACTCCAGGTCAAGTTAGCTGAGCTGCTAAAAGAAAATAAATCTTTGAAAAGGCTTCAGTACAGACAGGAGAAAGCCCTGAATAAGTTTGAAGATGCCGAAAATGAAATCTCACAACTTATATTTCGTCATAACAATGAGATTACAGCACTCAAAGAACGCTTAAGAAAATCTCAAGAGAAAGAACGGGCAACTGAGAAAAGGGTAAAAGATACAGAAAGTGAACTATTTAGGACAAAATTTTCCTTACAGAAACTGAAAGAGATCTCTGAAGCTAGACACCTACCTGAACGAGATGATTTGGCAAAGAAACTAGTTTCAGCAGAGTTAAAGTTAGATGACACCGAGAGAAGAATTAAGGAGCTATCGAAAAACCTTGAACTGAGTACTAACAGTTTCCAACGACAGTTGCTTGCTGAAAGGAAAAGGGCATATGAGGCTCATGATGAAAATAAAGTTCTTCAAAAGGAGGTACAGCGACTATATCACAAATTAAAGGAAAAGGAGAGAGAACTGGATATAAAAAATATATATTCTAATCGTCTGCCAAAGTCCTCTCCAAATAAAGAGAAAGAACTTGCATTAAGAAAAAATGCTGCATGCCAGAGTGATTTTGCAGACCTGTGTACAAAAGGAGTACAAACCATGGAAGACTTCAAGCCAGAAGAATATCCTTTAACTCCAGAAACAATTATGTGTTACGAAAACAAATGGGAAGAACCAGGACATCTTACTTTGGACTTGCAATCTCAAAAGCAAGACAGGCATGGAGAAGCAGGGATTCTAAACCCAATTATGGAAAGAGAAGAAAAATTTGTTACAGATGAAGAACTCCATGTCGTAAAACAGGAGGTTGAAAAGCTGGAGGATGAATGGGAAAGAGAAGAACTTGATAAAAAGCAAAAAGAAAAGGCATCTTTACTGGAAAGAGAAGAAAAGCCAGAGTGGGAAACTGGAAGGTACCAACTAGGAATGTATCCAATTCAGAATATGGATAAATTGCAAGGAGAGGAAGAAGAAAGACTGAAGAGAGAAATGCTACTTGCTAAACTGAATGAAATTGACAGAGAACTCCAAGATTCTCGAAATCTAAAATACCCTGTTTTGCCATTGTTACCTGATTTTGAATCAAAACTACACTCCCGAGAGAGAAGCCCCAAAACATACAGGTTCTCTGAATCCTCAGAGAGATTATTTAATGGGCATCATTTGCAAGACATCAGTTTCTCAACTCCAAAAGGAGAAGGTCAGAATTCAGGAAATGTTAGAAGTCCAGCCTCCCCTAATGAGTTCGCATTTGGTAGCTACGTGCCTTCGTTTGCAAAAACATCAGAGAGGTCAAATCCATTTAGTCAAAAAAGTAGTTTTTTGGATTTCCAAAGAAACAGTATGGAAAAACTTAGTAAAGATGGTGTAGATTTAATTACAAGAAAAGAGAAAAAAGCTAATTTGATGGAACAGTTATTTGGTGCCAGTGGTAGCAGCACCATTTCCTCCAAAAGCAGTGGCCCAAATTCTGTGGCTTCCAGTAAAGGAGACATTGACCCTCTAAATTTTCTCCCTGGGAATAAAGGCAGCAGAGATCAAGAACATGATGAAGATGAAGGCTTTTTCCTCAGTGAAGGAAGAAGTTTTAATCCAAATAGGCACCGATTAAAACATGCAGACGATAAACCAGCAGTAAAAGCAGCTGATTCTGTAGAAGATGAAATTGAAGAAGTAGCACTGAGATGA

Length: 2094

View AllClose

0 Reviews

View AllClose