Human LBR cDNA Clone BC020079 pENTR223.1 or pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL613520HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
LBR
Gene ID:
3930
Accession #:
BC020079
Plasmid:
Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
€347.00
Frequently bought together:

Description

Human LBR cDNA Clone BC020079 pENTR223.1 or pUC Plasmid | Cusabio

Gene Name: LBR

Gene ID: 3930

Accession Number: BC020079

Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGCCAAGTAGGAAATTTGCCGATGGTGAAGTGGTAAGAGGTCGATGGCCTGGGAGTTCACTTTATTATGAAGTAGAAATTCTGAGCCACGACAGCACCTCCCAGCTTTACACTGTGAAGTATAAAGATGGAACAGAGCTTGAATTGAAAGAGAATGATATTAAGCCTTTAACTTCCTTTAGGCAAAGGAAAGGTGGCTCAACTTCCAGTTCCCCTTCCAGACGCCGAGGGAGTCGATCAAGGTCACGCTCCCGATCCCCTGGTCGACCACCTAAAAGTGCCCGCCGATCTGCTTCTGCTTCCCACCAGGCCGACATTAAGGAAGCAAGGAGGGAAGTGGAAGTTAAATTGACTCCGCTGATTCTGAAGCCATTTGGAAATAGCATCAGCAGATATAATGGGGAGCCTGAGCATATTGAGAGAAATGACGCACCTCATAAAAATACACAGGAAAAATTCAGTTTGTCACAAGAAAGCAGTTACATAGCAACACAGTATAGCCTTCGTCCAAGAAGAGAAGAAGTCAAATTAAAAGAAATAGATTCTAAGGAAGAAAAATACGTTGCAAAAGAACTGGCAGTGAGAACCTTTGAAGTGACCCCCATCCGGGCAAAGGACTTGGAGTTTGGAGGAGTACCTGGTGTGTTTCTCATCATGTTTGGCCTGCCTGTGTTCCTCTTCCTGTTGCTGTTGATGTGTAAACAGAAAGATCCCAGTCTTCTGAATTTCCCTCCTCCTTTGCCAGCTTTGTATGAGTTATGGGAAACCAGAGTATTTGGGGTCTACCTCCTGTGGTTTTTGATTCAAGTCCTGTTCTACCTACTGCCAATTGGAAAGGTTGTAGAAGGAACGCCTCTTATTGATGGAAGAAGACTCAAGTATAGATTAAATGGATTCTATGCTTTTATCCTGACATCTGCAGTCATCGGAACATCTCTCTTCCAGGGCGTAGAGTTTCATTACGTGTACAGTCATTTTCTTCAGTTTGCACTTGCGGCCACTGTTTTTTGTGTGGTCTTGAGTGTGTATCTCTACATGCGCTCTTTGAAAGCGCCCCGGAATGACCTGTCGCCTGCCAGCTCTGGAAATGCTGTCTATGATTTCTTCATTGGCCGTGAATTAAACCCTCGAATTGGTACTTTTGATCTCAAATACTTTTGTGAATTGCGCCCCGGATTGATTGGATGGGTGGTTATTAACTTGGTGATGCTTTTGGCTGAAATGAAAATACAGGACCGCGCTGTTCCATCCTTGGCCATGATTTTAGTTAATAGTTTCCAGCTTCTCTATGTGGTGGATGCTCTCTGGAATGAGGAAGCGTTGTTGACGACCATGGACATCATCCACGATGGATTTGGATTCATGCTGGCTTTTGGAGACTTGGTGTGGGTTCCCTTTATTTACAGCTTCCAAGCCTTTTATTTAGTCAGTCATCCAAATGAAGTGTCTTGGCCAATGGCTTCTCTAATTATTGTTCTGAAACTTTGTGGTTATGTAATCTTCCGAGGTGCAAATTCTCAGAAAAATGCATTCCGGAAAAATCCCAGTGATCCAAAGCTTGCACATTTAAAAACCATTCATACTTCAACGGGAAAAAATCTTCTAGTTTCTGGATGGTGGGGCTTTGTTCGCCACCCCAATTACTTGGGTGATCTCATCATGGCCTTGGCGTGGTCCCTCCCATGTGGTTTTAACCACATTCTGCCTTATTTCTACATAATTTATTTCACCATGTTGCTTGTCCACCGAGAAGCTCGTGACGAGTACCACTGTAAGAAGAAATACGGCGTGGCTTGGGAAAAGTACTGTCAGCGTGTGCCCTACCGTATATTTCCATACATCTACTAA

Length: 1848

View AllClose

0 Reviews

View AllClose