Human LBP cDNA Clone BC022256 pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL012775HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
LBP
Gene ID:
3929
Accession #:
BC022256
Plasmid:
pUC
€473.00
Frequently bought together:

Description

Human LBP cDNA Clone BC022256 pUC Plasmid | Cusabio

Gene Name: LBP

Gene ID: 3929

Accession Number: BC022256

Vector: pUC

Sequence: ATGGGGGCCTTGGCCAGAGCCCTGCCGTCCATACTGCTGGCATTGCTGCTTACGTCCACCCCAGAGGCTCTGGGTGCCAACCCCGGCTTGGTCGCCAGGATCACCGACAAGGGACTGCAGTATGCGGCCCAGGAGGGGCTATTGGCTCTGCAGAGTGAGCTGCTCAGGATCACGCTGCCTGACTTCACCGGGGACTTGAGGATCCCCCACGTCGGCCGTGGGCGCTATGAGTTCCACAGCCTGAACATCCACAGCTGTGAGCTGCTTCACTCTGCGCTGAGGCCTGTCCCTGGCCAGGGCCTGAGTCTCAGCATCTCCGACTCCTCCATCCGGGTCCAGGGCAGGTGGAAGGTGCGCAAGTCATTCTTCAAACTACAGGGCTCCTTTGATGTCAGTGTCAAGGGCATCAGCATTTCGGTCAACCTCCTGTTGGGCAGCGAGTCCTCCGGGAGGCCCACAGTTACTGCCTCCAGCTGCAGCAGTGACATCGCTGACGTGGAGGTGGACATGTCGGGAGACTTGGGGTGGCTGTTGAACCTCTTCCACAACCAGATTGAGTCCAAGTTCCAGAAAGTACTGGAGAGCAGGATTTGCGAAATGATCCAGAAATCGGTGTCCTCCGATCTACAGCCTTATCTCCAAACTCTGCCAGTTACAACAGAGATTGACAGTTTCGCCGACATTGATTATAGCTTAGTGGAAGCCCCTCGGGCAACAGCCCAGATGCTGGAGGTGATGTTTAAGGGTGAAATCTTTCATCGTAACCACCGTTCTCCAGTTACCCTCCTTGCTGCAGTCATGAGCCTTCCTGAGGAACACAACAAAATGGTCTACTTTGCCATCTCGGATTATGTCTTCAACACGGCCAGCCTGGTTTATCATGAGGAAGGATATCTGAACTTCTCCATCACAGATGACATGATACCGCCTGACTCTAATATCCGACTGACCACCAAGTCCTTCCGACCCTTCGTCCCACGGTTAGCCAGGCTCTACCCCAACATGAACCTGGAACTCCAGGGATCAGTGCCCTCTGCTCCGCTCCTGAACTTCAGCCCTGGGAATCTGTCTGTGGACCCCTATATGGAGATAGATGCCTTTGTGCTCCTGCCCAGCTCCAGCAAGGAGCCTGTCTTCCGGCTCAGTGTGGCCACTAATGTGTCCGCCACCTTGACCTTCAATACCAGCAAGATCACTGGGTTCCTGAAGCCAGGAAAGGTAAAAGTGGAACTGAAAGAATCCAAAGTTGGACTATTCAATGCAGAGCTGTTGGAAGCGCTCCTCAACTATTACATCCTTAACACCTTCTACCCCAAGTTCAATGATAAGTTGGCCGAAGGCTTCCCCCTTCCTCTGCTGAAGCGTGTTCAGCTCTACGACCTTGGGCTGCAGATCCATAAGGACTTCCCCTCCAGGAGGGACCACCCTCCCTGA

Length: 1434

View AllClose

0 Reviews

View AllClose