Human LBH cDNA Clone BC126434 pENTR223.1 or pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL700659HU2
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
LBH
Gene ID:
81606
Accession #:
BC126434
Plasmid:
Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
$256.80
Frequently bought together:

Description

Human LBH cDNA Clone BC126434 pENTR223.1 or pUC Plasmid | Cusabio

Gene Name: LBH

Gene ID: 81606

Accession Number: BC126434

Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGTCTATATATTTCCCCATTCACTGCCCCGACTATCTGAGATCGGCCAAGATGACTGAGGTGATGATGAACACCCAGCCCATGGAGGAGATCGGCCTCAGCCCCCGCAAGGATGGCCTTTCCTACCAGATCTTCCCAGACCCGTCAGATTTTGACCGCTGCTGCAAACTGAAGGACCGTCTGCCCTCCATAGTGGTGGAACCCACAGAAGGGGAGGTGGAGAGCGGGGAGCTCCGGTGGCCCCCTGAGGAGTTCCTGGTCCAGGAGGATGAGCAAGATAACTGCGAAGAGACAGCGAAAGAAAATAAAGAGCAGTAG

Length: 318

View AllClose

0 Reviews

View AllClose