Human LATS1 cDNA Clone BC002767 pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL012769HU2
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
LATS1
Gene ID:
9113
Accession #:
BC002767
Plasmid:
pUC
€639.00
Frequently bought together:

Description

Human LATS1 cDNA Clone BC002767 pUC Plasmid | Cusabio

Gene Name: LATS1

Gene ID: 9113

Accession Number: BC002767

Vector: pUC

Sequence: ATGAAGAGGAGTGAAAAGCCAGAAGGATATAGACAAATGAGGCCTAAGACCTTTCCTGCCAGTAACTATACTGTCAGTAGCCGGCAAATGTTACAAGAAATTCGGGAATCCCTTAGGAATTTATCTAAACCATCTGATGCTGCTAAGGCTGAGCATAACATGAGTAAAATGTCAACCGAAGATCCTCGACAAGTCAGAAATCCACCCAAATTTGGGACGCATCATAAAGCCTTGCAGGAAATTCGAAACTCTCTGCTTCCATTTGCAAATGAAACAAATTCTTCTCGGAGTACTTCAGAAGTTAATCCACAAATGCTTCAAGACTTGCAAGCTGCTGGATTTGATGAGGATATGGTTATACAAGCTCTTCAGAAAACTAACAACAGAAGTATAGAAGCAGCAATTGAATTCATTAGTAAAATGAGTTACCAAGATCCTCGACGAGAGCAGATGGCTGCAGCAGCTGCCAGACCTATTAATGCCAGCATGAAACCAGGGAATGTGCAGCAATCAGTTAACCGCAAACAGAGCTGGAAAGGTTCTAAAGAATCCTTAGTTCCTCAGAGGCATGGCCCGCCACTAGGAGAAAGTGTGGCCTATCATTCTGAGAGTCCCAACTCACAGACAGATGTAGGAAGACCTTTGTCTGGATCTGGTATATCAGCATTTGTTCAAGCTCACCCTAGCAACGGACAGAGAGTGAACCCCCCACCACCACCTCAAGTAAGGAGTGTTACTCCTCCACCACCTCCAAGAGGCCAGACTCCCCCTCCAAGAGGTACAACTCCACCTCCCCCTTCATGGGAACCAAACTCTCAAACAAAGCGCTATTCTGGAAACATGGAATACGTAATCTCCCGAATCTCTCCTGTCCCACCTGGGGCATGGCAAGAGGGCTATCCTCCACCACCTCTCAACACTTCCCCCATGAATCCTCCTAATCAAGGACAGAGAGGCATTAGTTCTGTTCCTGTTGGCAGACAACCAATCATCATGCAGAGTTCTAGCAAATTTAACTTTCCATCAGGGAGACCTGGAATGCAGAATGGTACTGGACAAACTGATTTCATGATACACCAAAATGTTGTCCCTGCTGGCACTGTGAATCGGCAGCCACCACCTCCATATCCTCTGACAGCAGCTAATGGACAAAGCCCTTCTGCTTTACAAACAGGGGGATCTGCTGCTCCTTCGTCATATACAAATGGAAGTATTCCTCAGTCTATGATGGTGCCAAACAGAAATAGTCATAACATGGAACTATATAACATTAGTGTACCTGGACTGCAAACAAATTGGCCTCAGTCATCTTCTGCTCCAGCCCAGTCATCCCCGAGCAGTGGGCATGAAATCCCTACATGGCAACCTAACATACCAGTGAGGTCAAATTCTTTTAATAACCCATTAGGAAATAGAGCAAGTCACTCTGCTAATTCTCAGCCTTCCGCTACAACAGTCACTGCAATTACACCAGCTCCTATTCAACAGCCTGTGAAAAGTATGCGTGTATTAAAACCAGAGCTACAGACTGCTTTAGCACCTACACACCCTTCTTGGATACCACAGCCAATTCAAACTGTTCAACCCAGTCCTTTTCCTGAGGGAACCGCTTCAAATGTGACTGTGATGCCACCTGTTGCTGAAGCTCCAAACTATCAAGGACCACCACCACCCTACCCAAAACATCTGCTGCACCAAAACCCATCTGTTCCTCCATACGAGTCAATCAGTAAGCCTAGCAAAGAGGATCAGCCAAGCTTGCCCAAGGAAGATGAGAGTGAAAAGAGTTATGAAAATGTTGATAGTGGGGATAAAGAAAAGAAACAGATTACAACTTCACCTATTACTGTTAGGAAAAACAAGAAAGATGAAGAGCGAAGGGAATCTCGTATTCAAAGTTATTCTCCTCAAGCATTTAAATTCTTTATGGAGCAACATGTAGAAAATGTACTCAAATCTCATCAGCAGCGTCTACATCGTAAAAAACAATTAGAGAATGAAATGATGCGGGTAAAACCTTTTAAAATGTCCATTTTTATACTTAATCATCTGTTTGCTTGGTGTTTATTTTAA

Length: 2073

View AllClose

0 Reviews

View AllClose