Human LAT cDNA Clone BC011563 pENTR223.1 or pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL012767HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
LAT
Gene ID:
27040
Accession #:
BC011563
Plasmid:
Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
€214.00
Frequently bought together:

Description

Human LAT cDNA Clone BC011563 pENTR223.1 or pUC Plasmid | Cusabio

Gene Name: LAT

Gene ID: 27040

Accession Number: BC011563

Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGGAGGAGGCCATCCTGGTCCCCTGCGTGCTGGGGCTCCTGCTGCTGCCCATCCTGGCCATGTTGATGGCACTGTGTGTGCACTGCCACAGACTGCCAGGCTCCTACGACAGCACATCCTCAGATAGTTTGTATCCAAGGGGCATCCAGTTCAAACGGCCTCACACGGTTGCCCCCTGGCCACCTGCCTACCCACCTGTCACCTCCTACCCACCCCTGAGCCAGCCAGACCTGCTCCCCATCCCAAGATCCCCGCAGCCCCTTGGGGGCTCCCACCGGACGCCATCTTCCCGGCGGGATTCTGATGGTGCCAACAGTGTGGCGAGCTACGAGAACGAGGAACCAGCCTGTGAGGATGCGGATGAGGATGAGGACGACTATCACAACCCAGGCTACCTGGTGGTGCTTCCTGACAGCACCCCGGCCACTAGCACTGCTGCCCCATCAGCTCCTGCACTCAGCACCCCTGGCATCCGAGACAGTGCCTTCTCCATGGAGTCCATTGATGATTACGTGAACGTTCCGGAGAGCGGGGAGAGCGCAGAAGCGTCTCTGGATGGCAGCCGGGAGTATGTGAATGTGTCCCAGGAACTGCATCCTGGAGCGGCTAAGACTGAGCCTGCCGCCCTGAGTTCCCAGGAGGCAGAGGAAGTGGAGGAAGAGGGGGCTCCAGATTACGAGAATCTGCAGGAGCTGAACTGA

Length: 702

View AllClose

0 Reviews

View AllClose