Human LASP1 cDNA Clone BC012460 pENTR223.1 or pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL613523HU1
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
LASP1
Gene ID:
3927
Accession #:
BC012460
Plasmid:
Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
€214.00
Frequently bought together:

Description

Human LASP1 cDNA Clone BC012460 pENTR223.1 or pUC Plasmid | Cusabio

Gene Name: LASP1

Gene ID: 3927

Accession Number: BC012460

Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGAACCCCAACTGCGCCCGGTGCGGCAAGATCGTGTATCCCACGGAGAAGGTGAACTGTCTGGATAAGTTCTGGCATAAAGCATGCTTCCATTGCGAGACCTGCAAGATGACACTGAACATGAAGAACTACAAGGGCTACGAGAAGAAGCCCTACTGCAACGCACACTACCCCAAGCAGTCCTTCACCATGGTGGCGGACACCCCGGAAAACCTTCGCCTCAAGCAACAGAGTAGGCTCCAGAGTCAGGTGCGCTACAAGGAGGAGTTTGAGAAGAACAAGGGCAAAGGTTTCAGCGTAGTGGCAGACACGCCCGAGCTCCAGAGAATCAAGAAGACCCAGGACCAGATCAGTAATATCAAATACCATGAGGAGTTTGAGAAGAGCCGCATGGGCCCTAGCGGGGGCGAGGGCATGGAGCCAGAGCGTCGGGATTCGCAGGACGGCAGCAGCTACCGGCGGCCCCTGGAGCAGCAGCAGCCTCACCACATCCCGACCAGTGCCCCGGTTTACCAGCAGCCCCAGCAGCAGCCGGTGGCCCAGTCCTATGGTGGCTACAAGGAGCCTGCAGCCCCAGTCTCCATACAGCGCAGCGCCCCAGGTGGTGGCGGGAAGCGGTACCGCGCGGCGTATGACTACAGCGCCGCCGACGAGGACGCGGTCTCCTTCCAGGACGGGGACACCATCGTCAACGTGCAGCAGATCGACGACGGCTGGATGTACGGGACGGTGGAGCGCACCGGCGACACGGGGATGCTGCCGGCCAACTACGTGGAGGCCATTTGA

Length: 786

View AllClose

0 Reviews

View AllClose