Human LARS2 cDNA Clone BC025989 pENTR223.1 or pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL613580HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
LARS2
Gene ID:
23395
Accession #:
BC025989
Plasmid:
Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
€516.00
Frequently bought together:

Description

Human LARS2 cDNA Clone BC025989 pENTR223.1 or pUC Plasmid | Cusabio

Gene Name: LARS2

Gene ID: 23395

Accession Number: BC025989

Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGGCTTCTGTTTGGCAGAGATTGGGTTTTTATGCCTCTCTTCTGAAAAGACAGCTAAATGGTGGGCCAGATGTCATCAAGTGGGAAAGGAGAGTAATTCCCGGATGTACCAGAAGCATCTACAGTGCCACGGGAAAGTGGACAAAAGAGTATACATTGCAGACAAGAAAGGATGTTGAGAAATGGTGGCATCAACGAATAAAAGAACAGGCCTCCAAAATTTCAGAAGCTGATAAATCGAAGCCAAAATTTTACGTGCTTTCCATGTTCCCTTATCCTTCTGGTAAGCTGCACATGGGCCATGTGCGTGTCTACACCATCAGCGACACCATAGCACGGTTCCAGAAGATGAGAGGGATGCAGGTCATCAACCCCATGGGATGGGATGCTTTTGGATTGCCTGCTGAAAATGCCGCAGTCGAGAGGAATCTACATCCACAAAGTTGGACACAAAGTAATATTAAACACATGAGGAAACAGCTTGATCGTCTGGGCCTGTGTTTCAGCTGGGATAGGGAAATAACTACGTGTTTGCCAGATTACTACAAGTGGACTCAGTATCTCTTTATTAAACTGTATGAGGCTGGGCTGGCCTATCAAAAGGAGGCCCTGGTTAACTGGGACCCAGTGGATCAAACAGTGCTTGCCAATGAGCAGGTGGATGAACATGGCTGTTCATGGCGTTCTGGAGCAAAGGTGGAACAGAAGTACCTCAGACAATGGTTTATTAAGACAACCGCTTATGCAAAGGCCATGCAGGACGCGTTGGCAGACCTTCCAGAATGGTATGGAATAAAAGGCATGCAAGCCCACTGGATTGGGGACTGTGTGGGCTGCCACCTGGACTTCACATTAAAGGTTCATGGGCAAGCCACGGGCGAAAAGCTGACTGCCTATACGGCCACCCCTGAAGCCATTTATGGCACCTCCCACGTGGCCATCTCGCCCAGCCACAGACTCCTACATGGGCACAGCTCTCTGAAGGAAGCCTTGAGGATGGCCCTTGTCCCTGGCAAAGATTGCCTCACGCCTGTAATGGCTGTGAACATGCTCACCCAGCAGGAGGTCCCTGTCGTTATTTTGGCCAAAGCTGACTTGGAAGGCTCTCTGGATTCAAAAATAGGAATTCCCAGTACTAGCTCAGAGGACACCATCTTAGCCCAAACCCTGGGCCTGGCCTACTCTGAAGTCATTGAAACTTTGCCAGATGGCACAGAGAGACTGAGCAGCTCTGCTGAGTTCACAGGTATGACCCGGCAGGATGCTTTTCTAGCCCTGACTCAGAAAGCCCGGGGGAAGAGAGTGGGTGGAGACGTGACAAGTGATAAACTGAAAGACTGGCTGATTTCACGGCAGCGGTACTGGGGCACACCAATCCCCATTGTCCACTGCCCAGTCTGTGGCCCCACACCTGTGCCCCTGGAGGACTTGCCTGTGACCCTGCCCAACATCGCATCTTTCACTGGCAAGGGAGGCCCCCCACTGGCCATGGCTTCAGAGTGGGTGAACTGCTCCTGCCCAAGGTGCAAGGGAGCAGCCAAGAGAGAGACAGACACGATGGATACCTTTGTTGATTCTGCTTGGTACTACTTCAGATACACTGACCCTCATAATCCACACAGCCCTTTTAACACAGCAGTGGCCGATTACTGGATGCCTGTGGATTTGTACATTGGAGGGAAAGAACATGCCGTCATGCACTTGTTCTATGCAAGATTCTTTAGTCATTTTTGCCATGATCAAAAAATGGTTAAACATAGGGAGCCTTTTCATAAGCTGCTGGCCCAAGGCCTTATCAAGGGGCAGACATTCCGCCTACCATCTGGACAGTATCTACAGAGAGAGGAAGTGGATCTCACAGGTTCCGTTCCTGTTCATGCAAAAACGAAAGAGAAGTTAGAGGTGACGTGGGAGAAGATGAGTAAGTCCAAACACAACGGGGTGGACCCAGAGGAAGTTGTGGAGCAGTATGGGATCGACACGATTCGGCTCTACATCCTTTTTGCTGCCCCTCCTGAGAAGGATATCTTGTGGGATGTGAAAACTGATGCTCTCCCTGGGGTGCTGAGATGGCAACAACGACTGTGGACCTTGACAACTCGGTTTATTGAGGCCAGGGCTTCTGGGAAGTCTCCCCAGCCTCAGCTGCTGAGTAACAAGGAGAAAGCCGAGGCCAGGAAGCTCTGGGAGTACAAGAACTCCGTCATCTCTCAGGTGACCACCCATTTCACAGAGGACTTCTCACTGAATTCTGCAATTTCTCAGCTGATGGGACTCAGCAATGCCCTCTCGCAAGCCTCTCAGAGCGTCATTCTCCACAGCCCCGAGTTTGAGGATGCTTTGTGTGCCCTGATGGTGATGGCTGCTCCACTGGCCCCTCATGTAACCTCAGAGATCTGGGCAGGCCTGGCGCTGGTGCCGAGGAAGCTCTGTGCCCACTACACTTGGGATGCCAGTGTGCTGCTCCAGGCATGGCCTGCTGTGGACCCGGAGTTCCTGCAGCAGCCTGAGGTTGTCCAGATGGCAGTTCTGATCAACAATAAAGCTTGTGGCAAAATTCCTGTGCCCCAACAAGTTGCCCGGGACCAGGACAAAGTCCACGAATTTGTTCTTCAAAGCGAGCTGGGTGTCAGGCTTTTGCAAGGACGAAGCATCAAGAAGTCCTTCCTTTCCCCGAGAACTGCCCTCATCAACTTCCTGGTGCAAGATTGA

Length: 2712

View AllClose

0 Reviews

View AllClose