Human LARP6 cDNA Clone BC006082 pENTR223.1 or pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL887112HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
LARP6
Gene ID:
55323
Accession #:
BC006082
Plasmid:
Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
$256.80
Frequently bought together:

Description

Human LARP6 cDNA Clone BC006082 pENTR223.1 or pUC Plasmid | Cusabio

Gene Name: LARP6

Gene ID: 55323

Accession Number: BC006082

Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGGCCCAGTCCGGCGGGGAGGCTCGGCCCGGGCCCAAGACGGCGGTGCAGATCCGCGTCGCCATCCAGGAGGCCGAGGACGTGGACGAGTTGGAGGACGAGGAGGAGGGGGCGGAGACTCGGGGCGCCGGGGACCCGGCCCGGTACCTCAGCCCCGGCTGGGGCAGCGCGAGCGAGGAGGAGCCGAGCCGCGGGCACAGTGGCACCACTGCAAGTGGAGGTGAGAACGAGCGTGAGGACCTGGAGCAGGAGTGGAAGCCCCCGGATGAGGAGTTGATCAAGAAACTGGTGGATCAGATCGAATTCTACTTTTCTGATGAAAACCTGGAGAAGGACGCCTTTTTGCTAAAACACGTGAGGAGGAACAAGCTGGGATATGTGAGCGTTAAGCTACTCACATCCTTCAAAAAGGTGAAACATCTTACACGGGACTGGAGAACCACAGCACATGCTTTGAAGTATTCAGTGGTCCTTGAGTTGAATGAGGACCACCGGAAGGTGAGGAGGACCACCCCCGTCCCACTGTTCCCCAACGAGAACCTCCCCAGCAAGATGCTCCTGGTCTATGATCTCTACTTGTCTCCTAAGCTGTGGGCTCTGGCCACCCCCCAGAAGAATGGAAGGGTGCAAGAGAAGGTGATGGAACACCTGCTCAAGCTTTTTGGGACTTTTGGAGTCATCTCATCAGTGCGGATCCTCAAACCTGGGAGAGAGCTGCCCCCTGACATCCGGAGGATCAGCAGCCGCTACAGCCAAGTGGGGACCCAGGAGTGCGCCATCGTGGAGTTCGAGGAGGTGGAAGCAGCCATCAAAGCCCATGAGTTCATGATCACAGAATCTCAGGGCAAAGAGAACATGAAAGCTGTCCTGATTGGTATGAAGCCACCCAAAAAGAAACCTGCCAAAGACAAAAATCATGACGAGGAGCCCACTGCGAGCATCCACCTGAACAAGTCCCTGAACAAGAGAGTCGAGGAGCTTCAGTACATGGGTGATGAGTCTTCTGCCAACAGCTCCTCTGACCCCGAGAGCAACCCCACATCCCCTATGGCGGGCCGACGGCACGCGGCCACCAACAAGCTCAGCCCGTCTGGCCACCAGAATCTCTTTCTGAGTCCAAATGCCTCCCCGTGCACAAGTCCTTGGAGCAGCCCCTTGGCCCAACGCAAAGGCGTTTCCAGAAAGTCCCCACTGGCGGAGGAAGGTAGACTGAACTGCAGCACCAGCCCTGAGATCTTCCGCAAGTGTATGGATTATTCCTCTGACAGCAGCGTCACTCCCTCTGGCAGCCCCTGGGTCCGGAGGCGTCGCCAAGCCGAGATGGGGACCCAGGAGAAAAGCCCCGGTACGAGTCCCCTGCTCTCCCGGAAGATGCAGACTGCAGATGGGCTACCCGTAGGGGTGCTGAGGTTGCCCAGGGGTCCTGACAACACCAGAGGATTTCATGGCCATGAGAGGAGCAGGGCCTGTGTATAA

Length: 1476

View AllClose

0 Reviews

View AllClose