Human LARP4 cDNA Clone BC063479 pENTR223.1 or pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL758266HU1
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
LARP4
Gene ID:
113251
Accession #:
BC063479
Plasmid:
Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
€214.00
Frequently bought together:

Description

Human LARP4 cDNA Clone BC063479 pENTR223.1 or pUC Plasmid | Cusabio

Gene Name: LARP4

Gene ID: 113251

Accession Number: BC063479

Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGTTGCTTTTCGTGGAGCAGGTAGCATCTAAAGGAACTGGTTTAAATCCTAATGCCAAAGTATGGCAAGAAATTGCTCCTGGAAATACTGATGCCACCCCAGTAACTCATGGAACTGAAAGCTCTTGGCATGAAATAGCAGCTACATCAGGTGCTCATCCTGAGGGTAATGCAGAGCTCTCAGAAGATATATGTAAAGAATATGAAGTAATGTATTCTTCATCTTGTGAAACCACAAGAAATACTACAGGCATTGAAGAATCAACTGATGGGATGATTTTAGGACCAGAAGATCTGAGTTACCAAATATATGATGTTTCCGGAGAAAGCAATTCAGCAGTTTCTACAGAAGACCTAAAAGAATGTCTGAAGAAACAATTAGAATTCTGTTTTTCACGAGAAAATTTGTCAAAGGATCTTTACTTGATATCTCAAATGGATAGTGATCAGTTCATCCCAATTTGGACAGTTGCCAACATGGAAGAAATAAAAAAGTTGACTACAGACCCTGATCTAATTCTTGAAGTGTTAAGATCTTCTCCCATGGTACAAGTTGATGAGAAGGGTGAGAAAGTGAGACCAAGTCATAAGCGTTGTATTGTAATTCTTAGAGAGATTCCTGAAACAACACCAATAGAGGAAGTGAAAGGTTTGTTCAAAAGTGAAAACTGCCCCAAAGTGATAAGCTGTGAGTTTGCACACAATAGCAACTGGTATATCACTTTCCAGTCAGACACAGATGCACAACAGGCTTTTAAATACTTAAGAGAAGAAGTTAAAACATTTCAGGGCAAGCCAATTATGGCAAGGATAAAAGCCATCAATACATTTTTTGCTAAGAATGGTTATCGATTAATGGATTCTAGTATCTATAGTCACCCCATTCAAACTCAAGCACAGTATGCCTCCCCAGTCTTTATGCAGCCTGTATATAATCCTCACCAACAGTACTCGGTCTATAGTATTGTGCCTCAGTCTTGGTCTCCAAATCCTACACCTTACTTTGAAACACCACTGGCTCCCTTTCCCAATGGTAGTTTTGTGAATGGCTTTAATTCGCCAGGATCTTATAAAACAAATGCTGCTGCTATGAATATGGGTCGACCATTCCAAAAAATCGTGTGA

Length: 1125

View AllClose

0 Reviews

View AllClose