Human LARGE cDNA Clone BC117425 pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL012749HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
LARGE
Gene ID:
9215
Accession #:
BC117425
Plasmid:
pUC
€690.00
Frequently bought together:

Description

Human LARGE cDNA Clone BC117425 pUC Plasmid | Cusabio

Gene Name: LARGE

Gene ID: 9215

Accession Number: BC117425

Vector: pUC

Sequence: ATGCTGGGAATCTGCAGGGGGAGACGGAAATTCTTGGCTGCCTCGTTGAGTCTTCTCTGCATCCCAGCCATCACCTGGATTTACCTGTTTTCTGGGAGCTTCGAAGATGGAAAGCCCGTGTCTCTGTCACCGCTGGAGTCCCAGGCACACAGCCCCAGGTACACGGCCTCCAGCCAGCGGGAGCGCGAGAGCCTGGAGGTGCGCATGCGCGAGGTGGAGGAGGAGAACCGCGCCCTCCGCAGGCAGCTCAGCCTGGCCCAGGGCCGAGCCCCATCCCATCGCCGAGGCAACCACTCCAAGACCTACTCCATGGAGGAGGGCACTGGAGACAGCGAGAACCTTCGGGCTGGCATCGTGGCAGGCAACAGCTCCGAGTGTGGGCAGCAGCCGGTCGTGGAGAAATGCGAGACAATCCACGTTGCTATTGTCTGCGCCGGATACAATGCCAGCCGGGATGTCGTCACCCTGGTCAAATCCGTCCTGTTCCATAGACGGAACCCTCTGCACTTCCACCTTATTGCTGACTCCATTGCGGAGCAGATCCTGGCCACGCTCTTCCAGACCTGGATGGTGCCCGCTGTGCGTGTGGACTTCTACAATGCAGACGAGCTCAAGTCTGAAGTTTCCTGGATCCCCAATAAACATTACTCTGGGATTTATGGTCTGATGAAGCTTGTCCTGACCAAGACTCTTCCTGCCAACCTGGAGAGAGTCATCGTCCTTGACACGGATATCACCTTTGCCACTGACATTGCAGAGCTGTGGGCTGTGTTCCACAAGTTCAAAGGTCAGCAAGTCCTGGGCTTGGTGGAGAACCAGAGTGACTGGTACCTTGGAAACCTGTGGAAAAATCACCGCCCATGGCCAGCCCTTGGAAGAGGCTACAACACAGGGGTGATCCTGTTACTTCTGGATAAGCTGCGGAAGATGAAATGGGAGCAGATGTGGAGGCTGACCGCAGAGAGGGAGCTCATGGGCATGCTCTCTACATCCTTAGCTGACCAGGATATTTTCAATGCCGTCATCAAACAAAACCCCTTCCTTGTGTACCAGCTCCCCTGCTTCTGGAATGTGCAGCTGTCAGACCACACCCGCTCCGAGCAGTGCTACAGAGACGTGTCTGATCTAAAGGTCATTCACTGGAACTCCCCCAAGAAGCTCCGGGTGAAGAACAAGCATGTGGAGTTTTTTCGCAACCTCTACCTGACCTTCCTGGAGTATGACGGCAATCTTCTGAGGCGGGAACTGTTTGGCTGCCCCAGTGAGGCTGATGTCAACAGTGAAAACCTCCAGAAGCAGCTGTCTGAGCTGGACGAGGACGACCTGTGCTATGAGTTCCGGCGAGAGCGCTTCACTGTCCACCGCACCCACCTGTACTTCCTGCACTACGAGTATGAGCCTGCAGCAGACAGCACGGACGTCACCCTGGTCGCTCAGCTGTCCATGGACAGGCTCCAGATGCTGGAGGCCATCTGCAAGCACTGGGAGGGGCCCATCAGCCTGGCCCTCTACCTGTCAGACGCCGAGGCCCAGCAGTTCCTCCGCTACGCACAGGGCTCTGAGGTGCTTATGAGCCGCCACAACGTGGGCTACCACATCGTGTACAAGGAGGGCCAGTTCTACCCCGTGAACCTGCTGCGCAACGTGGCCATGAAGCACATCAGCACTCCCTACATGTTCCTGTCTGACATTGACTTCCTGCCCATGTATGGGCTCTATGAGTACCTCAGGAAGTCTGTCATCCAGCTCGATCTTGCCAACACCAAGAAAGCAATGATTGTCCCCGCGTTCGAGACACTGCGCTACCGGCTGTCCTTCCCCAAGTCAAAAGCGGAGTTGCTGTCAATGCTGGACATGGGGACCCTCTTCACATTCAGGTACCACGTCTGGACGAAAGGCCACGCACCCACAAACTTCGCCAAGTGGCGGACCGCCACCACGCCTTACCGGGTTGAGTGGGAGGCCGATTTTGAGCCGTATGTTGTTGTGAGACGTGACTGCCCGGAGTACGACCGGAGGTTTGTAGGCTTTGGCTGGAACAAAGTGGCTCATATCATGGAGCTGGATGTGCAGGAGTATGAGTTCATTGTGCTGCCCAACGCCTACATGATCCACATGCCTCATGCCCCCAGCTTCGACATTACCAAGTTCCGTTCCAACAAGCAATACCGCATCTGTCTCAAAACCCTCAAGGAAGAGTTTCAGCAGGACATGTCCCGCCGCTACGGCTTTGCTGCCCTGAAATATCTCACAGCCGAGAACAACAGCTAG

Length: 2271

View AllClose

0 Reviews

View AllClose