Human LAP3 cDNA Clone BC065564 pENTR223.1 or pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL012745HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
LAP3
Gene ID:
51056
Accession #:
BC065564
Plasmid:
Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
£277.60
Frequently bought together:

Description

Human LAP3 cDNA Clone BC065564 pENTR223.1 or pUC Plasmid | Cusabio

Gene Name: LAP3

Gene ID: 51056

Accession Number: BC065564

Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGTTCTTGCTGCCTCTTCCGGCTGCGGGGCGAGTAGTCGTCCGACGTCTGGCCGTGAGACGTTTCGGGAGCCGGAGTCTCTCCACCGCAGACATGACGAAGGGCCTTGTTTTAGGAATCTATTCCAAAGAAAAAGAAGATGATGTGCCACAGTTCACAAGTGCAGGAGAGAATTTTGATAAATTGTTAGCTGGAAAGCTGAGAGAGACTTTGAACATATCTGGACCACCTCTGAAGGCAGGGAAGACTCGAACCTTTTATGGTCTGCATCAGGACTTCCCCAGCGTGGTGCTAGTTGGCCTCGGCAAAAAGGCAGCTGGAATCGACGAACAGGAAAACTGGCATGAAGGCAAAGAAAACATCAGAGCTGCTGTTGCAGCGGGGTGCAGGCAGATTCAAGACCTGGAGCTCTCGTCTGTGGAGGTGGATCCCTGTGGAGACGCTCAGGCTGCTGCGGAGGGAGCGGTGCTTGGTCTCTATGAATACGATGACCTAAAGCAAAAAAAGAAGATGGCTGTGTCGGCAAAGCTCTATGGAAGTGGGGATCAGGAGGCCTGGCAGAAAGGAGTCCTGTTTGCTTCTGGGCAGAACTTGGCACGCCAATTGATGGAGACGCCAGCCAATGAGATGACGCCAACCAGATTTGCCGAAATTATTGAGAAGAATCTCAAAAGTGCTAGTAGTAAAACCGAGGTCCATATCAGACCCAAGTCTTGGATTGAGGAACAGGCAATGGGATCATTCCTCAGTGTGGCCAAAGGATCTGACGAGCCCCCAGTCTTCTTGGAAATTCACTACAAAGGCAGCCCCAATGCAAACGAACCACCCCTGGTGTTTGTTGGGAAAGGAATTACCTTTGACAGTGGTGGTATCTCCATCAAGGCTTCTGCAAATATGGACCTCATGAGGGCTGACATGGGAGGAGCTGCAACTATATGCTCAGCCATCGTGTCTGCTGCAAAGCTTAATTTGCCCATTAATATTATAGGTCTGGCCCCTCTTTGTGAAAATATGCCCAGCGGCAAGGCCAACAAGCCGGGGGATGTTGTTAGAGCCAAAAACGGGAAGACCATCCAGGTTGATAACACTGATGCTGAGGGGAGGCTCATACTGGCTGATGCGCTCTGTTACGCACACACGTTTAACCCGAAGGTCATCCTCAATGCCGCCACCTTAACAGGTGCCATGGATGTAGCTTTGGGATCAGGTGCCACTGGGGTCTTTACCAATTCATCCTGGCTCTGGAACAAACTCTTCGAGGCCAGCATTGAAACAGGGGACCGTGTCTGGAGGATGCCTCTCTTCGAACATTATACAAGACAGGTTGTAGATTGCCAGCTTGCTGATGTTAACAACATTGGAAAATACAGATCTGCAGGAGCATGTACAGCTGCAGCATTCCTGAAAGAATTCGTAACTCATCCTAAGTGGGCACATTTAGACATAGCAGGCGTGATGACCAACAAAGATGAAGTTCCCTATCTACGGAAAGGCATGACTGGGAGGCCCACAAGGACTCTCATTGAGTTCTTACTTCGTTTCAGTCAAGACAATGCTTAG

Length: 1560

View AllClose

0 Reviews

View AllClose