Human LANCL2 cDNA Clone BC070049 pENTR223.1 or pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL865129HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
LANCL2
Gene ID:
55915
Accession #:
BC070049
Plasmid:
Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
$256.80
Frequently bought together:

Description

Human LANCL2 cDNA Clone BC070049 pENTR223.1 or pUC Plasmid | Cusabio

Gene Name: LANCL2

Gene ID: 55915

Accession Number: BC070049

Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGGGCGAGACCATGTCAAAGAGGCTGAAGCTCCACCTGGGAGGGGAGGCAGAAATGGAGGAACGGGCGTTCGTCAACCCCTTCCCGGACTACGAGGCCGCCGCCGGGGCGCTGCTCGCCTCCGGAGCGGCCGAAGAGACAGGCTGTGTTCGTCCCCCGGCCACCCCGGATGAGCCCGGCCTCCCTTTTCATCAGGACGGGAAGATCATTCATAATTTCATAAGACGGATCCAGACCAAAATTAAAGATCTTCTGCAGCAAATGGAAGAAGGGCTGAAGACAGCTGATCCCCATGACTGCTCTGCTTATACTGGCTGGACAGGCATAGCCCTTTTGTACCTGCAGTTGTACCGGGTCACATGTGACCAAACCTACCTGCTCCGATCCCTGGATTACGTAAAAAGAACACTTCGGAATCTGAATGGCCGCAGGGTCACCTTCCTCTGTGGGGATGCTGGCCCCCTGGCTGTTGGAGCTGTGATTTATCACAAACTCAGAAGTGACTGTGAGTCCCAGGAATGTGTCACAAAACTTTTGCAGCTCCAGAGATCGGTTGTCTGCCAAGAATCAGACCTTCCTGATGAGCTGCTTTATGGACGGGCAGGTTATCTGTATGCCTTACTGTACCTGAACACAGAGATAGGTCCAGGCACCGTGTGTGAGTCAGCTATTAAAGAGGTAGTCAATGCTATTATTGAATCGGGTAAGACTTTGTCAAGGGAAGAAAGAAAAACGGAGCGCTGCCCGCTGTTGTACCAGTGGCACCGGAAGCAGTACGTTGGAGCAGCCCATGGCATGGCTGGAATTTACTATATGTTAATGCAGCCGGCAGCAAAAGTGGACCAAGAAACCTTGACAGAAATGGTGAAACCCAGTATTGATTATGTGCGCCACAAAAAATTCCGATCTGGGAATTACCCATCATCATTAAGCAATGAAACAGACCGGCTGGTGCACTGGTGCCACGGCGCCCCGGGGGTCATCCACATGCTCATGCAGGCGTACAAGGTCTTTAAGGAGGAGAAGTACTTGAAAGAGGCCATGGAGTGTAGCGATGTGATTTGGCAGCGAGGTTTGCTGCGGAAGGGCTACGGGATATGCCATGGGACTGCTGGCAACGGCTATTCCTTCCTGTCCCTTTACCGTCTCACGCAGGATAAGAAGTACCTCTACCGAGCTTGCAAGTTTGCAGAGTGGTGTCTAGATTACGGAGCACACGGGTGCCGCATTCCTGACAGACCCTATTCGCTCTTTGAAGGCATGGCTGGCGCTATTCACTTTCTCTCTGATGTCCTGGGACCAGAGACATCACGGTTTCCAGCATTTGAACTTGACTCTTCGAAGAGGGATTAA

Length: 1353

View AllClose

0 Reviews

View AllClose