Human LANCL1 cDNA Clone BC028685 pENTR223.1 Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL012742HU
Availability:
3 to 5 Working Days
Size:
10 μg plasmid + 200μl Glycerol
Gene:
LANCL1
Gene ID:
10314
Accession #:
BC028685
Plasmid:
pENTR223.1
€214.00
Frequently bought together:

Description

Human LANCL1 cDNA Clone BC028685 pENTR223.1 Plasmid | Cusabio

Gene Name: LANCL1

Gene ID: 10314

Accession Number: BC028685

Vector: pENTR223.1

Sequence: ATGGCTCAAAGGGCCTTCCCGAATCCTTATGCTGATTATAACAAATCCCTGGCCGAAGGCTACTTTGATGCTGCCGGGAGGCTGACTCCTGAGTTCTCACAACGCTTGACCAATAAGATTCGGGAGCTTCTTCAGCAAATGGAGAGAGGCCTGAAATCAGCAGACCCTCGGGATGGCACCGGTTACACTGGCTGGGCAGGTATTGCTGTGCTTTACTTACATCTTTATGATGTATTTGGGGACCCTGCCTACCTACAGTTAGCACATGGCTATGTAAAGCAAAGTCTGAACTGCTTAACCAAGCGCTCCATCACCTTCCTTTGTGGGGATGCAGGCCCCCTGGCAGTGGCCGCTGTGCTATATCACAAGATGAACAATGAGAAGCAGGCAGAAGATTGCATCACACGGCTAATTCACCTAAATAAGATTGATCCTCATGCTCCAAATGAAATGCTCTATGGGCGAATAGGCTACATCTATGCTCTTCTTTTTGTCAATAAGAACTTTGGAGTGGAAAAGATTCCTCAAAGCCATATTCAGCAGATTTGTGAAACAATTTTAACCTCTGGAGAAAACCTAGCTAGGAAGAGAAACTTCACGGCAAAGTCTCCACTGATGTATGAATGGTACCAGGAATATTATGTAGGGGCTGCTCATGGCCTGGCTGGAATTTATTACTACCTGATGCAGCCCAGCCTTCAAGTGAGCCAAGGGAAGTTACATAGTTTGGTCAAGCCCAGTGTAGACTACGTCTGCCAGCTGAAATTCCCTTCTGGCAATTACCCTCCATGTATAGGTGATAATCGAGATCTGCTTGTCCATTGGTGCCATGGCGCCCCTGGGGTAATCTACATGCTCATCCAGGCCTATAAGGTATTCAGAGAGGAAAAGTATCTCTGTGATGCCTATCAGTGTGCTGATGTGATCTGGCAATATGGGTTGCTGAAGAAGGGATATGGGCTGTGCCACGGTTCTGCAGGGAATGCCTATGCCTTCCTGACACTCTACAACCTCACACAGGACATGAAGTACCTGTATAGGGCCTGTAAGTTTGCTGAATGGTGCTTAGAGTATGGAGAACATGGATGCAGAACACCAGACACCCCTTTCTCTCTCTTTGAAGGAATGGCTGGAACAATATATTTCCTGGCTGACCTGCTAGTCCCCACAAAAGCCAGGTTCCCTGCATTTGAACTCTGA

Length: 1200

View AllClose

0 Reviews

View AllClose