Human LAMP2 cDNA Clone BC002965 pENTR223.1 Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL012740HU
Availability:
3 to 5 Working Days
Size:
10 μg plasmid + 200μl Glycerol
Gene:
LAMP2
Gene ID:
3920
Accession #:
BC002965
Plasmid:
pENTR223.1
€214.00
Frequently bought together:

Description

Human LAMP2 cDNA Clone BC002965 pENTR223.1 Plasmid | Cusabio

Gene Name: LAMP2

Gene ID: 3920

Accession Number: BC002965

Vector: pENTR223.1

Sequence: ATGGTGTGCTTCCGCCTCTTCCCGGTTCCGGGCTCAGGGCTCGTTCTGGTCTGCCTAGTCCTGGGAGCTGTGCGGTCTTATGCATTGGAACTTAATTTGACAGATTCAGAAAATGCCACTTGCCTTTATGCAAAATGGCAGATGAATTTCACAGTTCGCTATGAAACTACAAATAAAACTTATAAAACTGTAACCATTTCAGACCATGGCACTGTGACATATAATGGAAGCATTTGTGGGGATGATCAGAATGGTCCCAAAATAGCAGTGCAGTTCGGACCTGGCTTTTCCTGGATTGCGAATTTTACCAAGGCAGCATCTACTTATTCAATTGACAGCGTCTCATTTTCCTACAACACTGGTGATAACACAACATTTCCTGATGCTGAAGATAAAGGAATTCTTACTGTTGATGAACTTTTGGCCATCAGAATTCCATTGAATGACCTTTTTAGATGCAATAGTTTATCAACTTTGGAAAAGAATGATGTTGTCCAACACTACTGGGATGTTCTTGTACAAGCTTTTGTCCAAAATGGCACAGTGAGCACAAATGAGTTCCTGTGTGATAAAGACAAAACTTCAACAGTGGCACCCACCATACACACCACTGTGCCATCTCCTACTACAACACCTACTCCAAAGGAAAAACCAGAAGCTGGAACCTATTCAGTTAATAATGGCAATGATACTTGTCTGCTGGCTACCATGGGGCTGCAGCTGAACATCACTCAGGATAAGGTTGCTTCAGTTATTAACATCAACCCCAATACAACTCACTCCACAGGCAGCTGCCGTTCTCACACTGCTCTACTTAGACTCAATAGCAGCACCATTAAGTATCTAGACTTTGTCTTTGCTGTGAAAAATGAAAACCGATTTTATCTGAAGGAAGTGAACATCAGCATGTATTTGGTTAATGGCTCCGTTTTCAGCATTGCAAATAACAATCTCAGCTACTGGGATGCCCCCCTGGGAAGTTCTTATATGTGCAACAAAGAGCAGACTGTTTCAGTGTCTGGAGCATTTCAGATAAATACCTTTGATCTAAGGGTTCAGCCTTTCAATGTGACACAAGGAAAGTATTCTACAGCCCAAGAGTGTTCGCTGGATGATGACACCATTCTAATCCCAATTATAGTTGGTGCTGGTCTTTCAGGCTTGATTATCGTTATAGTGATTGCTTACGTAATTGGCAGAAGAAAAAGTTATGCTGGATATCAGACTCTGTAA

Length: 1233

View AllClose

0 Reviews

View AllClose