Human LAMP1 cDNA Clone BC021288 pENTR223.1 Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL012738HU
Availability:
3 to 5 Working Days
Size:
10 μg plasmid + 200μl Glycerol
Gene:
LAMP1
Gene ID:
3916
Accession #:
BC021288
Plasmid:
pENTR223.1
€214.00
Frequently bought together:

Description

Human LAMP1 cDNA Clone BC021288 pENTR223.1 Plasmid | Cusabio

Gene Name: LAMP1

Gene ID: 3916

Accession Number: BC021288

Vector: pENTR223.1

Sequence: ATGGCGGCCCCCGGCAGCGCCCGGCGACCCCTGCTGCTGCTACTGCTGTTGCTGCTGCTCGGCCTCATGCATTGTGCGTCAGCAGCAATGTTTATGGTGAAAAATGGCAACGGGACCGCGTGCATAATGGCCAACTTCTCTGCTGCCTTCTCAGTGAACTACGACACCAAGAGTGGCCCTAAGAACATGACCTTTGACCTGCCATCAGATGCCACAGTGGTGCTCAACCGCAGCTCCTGTGGAAAAGAGAACACTTCTGACCCCAGTCTCGTGATTGCTTTTGGAAGAGGACATACACTCACTCTCAATTTCACGAGAAATGCAACACGTTACAGCGTCCAGCTCATGAGTTTTGTTTATAACTTGTCAGACACACACCTTTTCCCCAATGCGAGCTCCAAAGAAATCAAGACTGTGGAATCTATAACTGACATCAGGGCAGATATAGATAAAAAATACAGATGTGTTAGTGGCACCCAGGTCCACATGAACAACGTGACCGTAACGCTCCATGATGCCACCATCCAGGCGTACCTTTCCAACAGCAGCTTCAGCAGGGGAGAGACACGCTGTGAACAAGACAGGCCTTCCCCAACCACAGCGCCCCCTGCGCCACCCAGCCCCTCGCCCTCACCCGTGCCCAAGAGCCCCTCTGTGGACAAGTACAACGTGAGCGGCACCAACGGGACCTGCCTGCTGGCCAGCATGGGGCTGCAGCTGAACCTCACCTATGAGAGGAAGGACAACACGACGGTGACAAGGCTTCTCAACATCAACCCCAACAAGACCTCGGCCAGCGGGAGCTGCGGCGCCCACCTGGTGACTCTGGAGCTGCACAGCGAGGGCACCACCGTCCTGCTCTTCCAGTTCGGGATGAATGCAAGTTCTAGCCGGTTTTTCCTACAAGGAATCCAGTTGAATACAATTCTTCCTGACGCCAGAGACCCTGCCTTTAAAGCTGCCAACGGCTCCCTGCGAGCGCTGCAGGCCACAGTCGGCAATTCCTACAAGTGCAACGCGGAGGAGCACGTCCGTGTCACGAAGGCGTTTTCAGTCAATATATTCAAAGTGTGGGTCCAGGCTTTCAAGGTGGAAGGTGGCCAGTTTGGCTCTGTGGAGGAGTGTCTGCTGGACGAGAACAGCATGCTGATCCCCATCGCTGTGGGTGGTGCCCTGGCGGGGCTGGTCCTCATCGTCCTCATCGCCTACCTCGTCGGCAGGAAGAGGAGTCACGCAGGCTACCAGACTATCTAG

Length: 1254

View AllClose

0 Reviews

View AllClose