Human LAMC1 cDNA Clone BC015586 pENTR223.1 or pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL012735HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
LAMC1
Gene ID:
3915
Accession #:
BC015586
Plasmid:
Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
€214.00
Frequently bought together:

Description

Human LAMC1 cDNA Clone BC015586 pENTR223.1 or pUC Plasmid | Cusabio

Gene Name: LAMC1

Gene ID: 3915

Accession Number: BC015586

Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGAACAAGCGAAGAACATCTCACAGGATCTGGAAAAACAAGCTGCCCGAGTACATGAGGAGGCCAAAAGGGCCGGTGACAAAGCTGTGGAGATCTATGCCAGCGTGGCTCAGCTGA

Length: 117

View AllClose

0 Reviews

View AllClose