Human LAMB3 cDNA Clone BC075838 pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL615717HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
LAMB3
Gene ID:
3914
Accession #:
BC075838
Plasmid:
pUC
€1,155.00
Frequently bought together:

Description

Human LAMB3 cDNA Clone BC075838 pUC Plasmid | Cusabio

Gene Name: LAMB3

Gene ID: 3914

Accession Number: BC075838

Vector: pUC

Sequence: ATGAGACCATTCTTCCTCTTGTGTTTTGCCCTGCCTGGCCTCCTGCATGCCCAACAAGCCTGCTCCCGTGGGGCCTGCTATCCACCTGTTGGGGACCTGCTTGTTGGGAGGACCCGGTTTCTCCGAGCTTCATCTACCTGTGGACTGACCAAGCCTGAGACCTACTGCACCCAGTATGGCGAGTGGCAGATGAAATGCTGCAAGTGTGACTCCAGGCAGCCTCACAACTACTACAGTCACCGAGTAGAGAATGTGGCTTCATCCTCCGGCCCCATGCGCTGGTGGCAGTCCCAGAATGATGTGAACCCTGTCTCTCTGCAGCTGGACCTGGACAGGAGATTCCAGCTTCAAGAAGTCATGATGGAGTTCCAGGGGCCCATGCCTGCCGGCATGCTGATTGAGCGCTCCTCAGACTTCGGTAAGACCTGGCGAGTGTACCAGTACCTGGCTGCCGACTGCACCTCCACCTTCCCTCGGGTCCGCCAGGGTCGGCCTCAGAGCTGGCAGGATGTTCGGTGCCAGTCCCTGCCTCAGAGGCCTAATGCACGCCTAAATGGGGGGAAGGTCCAACTTAACCTTATGGATTTAGTGTCTGGGATTCCAGCAACTCAAAGTCAAAAAATTCAAGAGGTGGGGGAGATCACAAACTTGAGAGTCAATTTCACCAGGCTGGCCCCTGTGCCCCAAAGGGGCTACCACCCTCCCAGCGCCTACTATGCTGTGTCCCAGCTCCGTCTGCAGGGGAGCTGCTTCTGTCACGGCCATGCTGATCGCTGCGCACCCAAGCCTGGGGCCTCTGCAGGCCCCTCCACCGCTGTGCAGGTCCACGATGTCTGTGTCTGCCAGCACAACACTGCCGGCCCAAATTGTGAGCGCTGTGCACCCTTCTACAACAACCGGCCCTGGAGACCGGCGGAGGGCCAGGACGCCCATGAATGCCAAAGGTGCGACTGCAATGGGCACTCAGAGACATGTCACTTTGACCCCGCTGTGTTTGCCGCCAGCCAGGGGGCATATGGAGGTGTGTGTGACAATTGCCGGGACCACACCGAAGGCAAGAACTGTGAGCGGTGTCAGCTGCACTATTTCCGGAACCGGCGCCCGGGAGCTTCCATTCAGGAGACCTGCATCTCCTGCGAGTGTGATCCGGATGGGGCAGTGCCAGGGGCTCCCTGTGACCCAGTGACCGGGCAGTGTGTGTGCAAGGAGCATGTGCAGGGAGAGCGCTGTGACCTATGCAAGCCGGGCTTCACTGGACTCACCTACGCCAACCCGCAGGGCTGCCACCGCTGTGACTGCAACATCCTGGGGTCCCGGAGGGACATGCCGTGTGACGAGGAGAGTGGGCGCTGCCTTTGTCTGCCCAACGTGGTGGGTCCCAAATGTGACCAGTGTGCTCCCTACCACTGGAAGCTGGCCAGTGGCCAGGGCTGTGAACCGTGTGCCTGCGACCCGCACAACTCCCTCAGCCCACAGTGCAACCAGTTCACAGGGCAGTGCCCCTGTCGGGAAGGCTTTGGTGGCCTGATGTGCAGCGCTGCAGCCATCCGCCAGTGTCCAGACCGGACCTATGGAGACGTGGCCACAGGATGCCGAGCCTGTGACTGTGATTTCCGGGGAACAGAGGGCCCGGGCTGCGACAAGGCATCAGGCCGCTGCCTCTGCCGCCCTGGCTTGACCGGGCCCCGCTGTGACCAGTGCCAGCGAGGCTACTGCAATCGCTACCCGGTGTGCGTGGCCTGCCACCCTTGCTTCCAGACCTATGATGCGGACCTCCGGGAGCAGGCCCTGCGCTTTGGTAGACTCCGCAATGCCACCGCCAGCCTGTGGTCAGGGCCTGGGCTGGAGGACCGTGGCCTGGCCTCCCGGATCCTAGATGCAAAGAGTAAGATTGAGCAGATCCGAGCAGTTCTCAGCAGCCCCGCAGTCACAGAGCAGGAGGTGGCTCAGGTGGCCAGTGCCATCCTCTCCCTCAGGCGAACTCTCCAGGGCCTGCAGCTGGATCTGCCCCTGGAGGAGGAGACGTTGTCCCTTCCGAGAGACCTGGAGAGTCTTGACAGAAGCTTCAATGGTCTCCTTACTATGTATCAGAGGAAGAGGGAGCAGTTTGAAAAAATAAGCAGTGCTGATCCTTCAGGAGCCTTCCGGATGCTGAGCACAGCCTACGAGCAGTCAGCCCAGGCTGCTCAGCAGGTCTCCGACAGCTCGCGCCTTTTGGACCAGCTCAGGGACAGCCGGAGAGAGGCAGAGAGGCTGGTGCGGCAGGCGGGAGGAGGAGGAGGCACCGGCAGCCCCAAGCTTGTGGCCCTGAGGCTGGAGATGTCTTCGTTGCCTGACCTGACACCCACCTTCAACAAGCTCTGTGGCAACTCCAGGCAGATGGCTTGCACCCCAATATCATGCCCTGGTGAGCTATGTCCCCAAGACAATGGCACAGCCTGTGGCTCCCGCTGCAGGGGTGTCCTTCCCAGGGCCGGTGGGGCCTTCTTGATGGCGGGGCAGGTGGCTGAGCAGCTGCGGGGCTTCAATGCCCAGCTCCAGCGGACCAGGCAGATGATTAGGGCAGCCGAGGAATCTGCCTCACAGATTCAATCCAGTGCCCAGCGCTTGGAGACCCAGGTGAGCGCCAGCCGCTCCCAGATGGAGGAAGATGTCAGACGCACACGGCTCCTAATCCAGCAGGTCCGGGACTTCCTAACAGACCCCGACACTGATGCAGCCACTATCCAGGAGGTCAGCGAGGCCGTGCTGGCCCTGTGGCTGCCCACAGACTCAGCTACTGTTCTGCAGAAGATGAATGAGATCCAGGCCATTGCAGCCAGGCTCCCCAACGTGGACTTGGTGCTGTCCCAGACCAAGCAGGACATTGCGCGTGCCCGCCGGTTGCAGGCTGAGGCTGAGGAAGCCAGGAGCCGAGCCCATGCAGTGGAGGGCCAGGTGGAAGATGTGGTTGGGAACCTGCGGCAGGGGACAGTGGCACTGCAGGAAGCTCAGGACACCATGCAAGGCACCAGCCGCTCCCTTCGGCTTATCCAGGACAGGGTTGCTGAGGTTCAGCAGGTACTGCGGCCAGCAGAAAAGCTGGTGACAAGCATGACCAAGCAGCTGGGTGACTTCTGGACACGGATGGAGGAGCTCCGCCACCAAGCCCGGCAGCAGGGGGCAGAGGCAGTCCAGGCCCAGCAGCTTGCGGAAGGTGCCAGCGAGCAGGCATTGAGTGCCCAAGAGGGATTTGAGAGAATAAAACAAAAGTATGCTGAGTTGAAGGACCGGTTGGGTCAGAGTTCCATGCTGGGTGAGCAGGGTGCCCGGATCCAGAGTGTGAAGACAGAGGCAGAGGAGCTGTTTGGGGAGACCATGGAGATGATGGACAGGATGAAAGACATGGAGTTGGAGCTGCTGCGGGGCAGCCAGGCCATCATGCTGCGCTCGGCGGACCTGACAGGACTGGAGAAGCGTGTGGAGCAGATCCGTGACCACATCAATGGGCGCGTGCTCTACTATGCCACCTGCAAGTGA

Length: 3519

View AllClose

0 Reviews

View AllClose