null

Human LAMA4 cDNA Clone BC004241 pENTR223.1 or pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL621948HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
LAMA4
Gene ID:
3910
Accession #:
BC004241
Plasmid:
Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
$256.80
Frequently bought together:

Description

Human LAMA4 cDNA Clone BC004241 pENTR223.1 or pUC Plasmid | Cusabio

Gene Name: LAMA4

Gene ID: 3910

Accession Number: BC004241

Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGGCTTTGAGCTCAGCCTGGCGCTCGGTTCTGCCTCTGTGGCTCCTCTGGAGCGCTGCCTGCTCCCGCGCCGCGTCCGGGGACGACAACGCTTTTCCTTTTGACATTGAAGGGAGCTCAGCGGTTGGCAGGCAAGACCCGCCTGAGACGAGCGAACCCCGCGTGGCTCTGGGACGCCTGCCGCCTGCGGCCGAGGTACAGTGTCCCTGCCATTGCCACCCTGCTGGGGCACCTGCGCCCCCGCGGGCTGTGCCACACTCGTCCTTCTCTCTCTCTCCGCCTCTTTCCTCTCCCCAGTGCCTTGAGAGTTTCACCTGGGCTAGGTCAGTTCGGAAACTTGAAATAAAGAGTTTTCCTTTGTAA

Length: 363

View AllClose

0 Reviews

View AllClose