Human LALBA cDNA Clone BC112316 pENTR223.1 or pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL012724HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
LALBA
Gene ID:
3906
Accession #:
BC112316
Plasmid:
Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
€214.00
Frequently bought together:

Description

Human LALBA cDNA Clone BC112316 pENTR223.1 or pUC Plasmid | Cusabio

Gene Name: LALBA

Gene ID: 3906

Accession Number: BC112316

Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGAGGTTCTTTGTCCCTCTGTTCCTGGTGGGCATCCTGTTCCCTGCCATCCTGGCCAAGCAATTCACAAAATGTGAGCTGTCCCAGCTGCTGAAAGACATAGATGGTTATGGAGGCATCGCTTTGCCTGAATTGATCTGTACCATGTTTCACACCAGTGGTTATGACACACAAGCCATAGTTGAAAACAATGAAAGCACGGAATATGGACTCTTCCAGATCAGTAATAAGCTTTGGTGCAAGAGCAGCCAGGTCCCTCAGTCAAGGAACATCTGTGACATCTCCTGTGACAAGTTCCTGGATGATGACATTACTGATGACATAATGTGTGCCAAGAAGATCCTGGATATTAAAGGAATTGACTACTGGTTGGCCCATAAAGCCCTCTGCACTGAGAAGCTGGAACAGTGGCTTTGTGAGAAGTTGTGA

Length: 429

View AllClose

0 Reviews

View AllClose