Human LAIR2 cDNA Clone BC069366 pENTR223.1 or pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL012722HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
LAIR2
Gene ID:
3904
Accession #:
BC069366
Plasmid:
Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
$256.80
Frequently bought together:

Description

Human LAIR2 cDNA Clone BC069366 pENTR223.1 or pUC Plasmid | Cusabio

Gene Name: LAIR2

Gene ID: 3904

Accession Number: BC069366

Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGTCTCCACACCTCACTGCTCTCCTGGGCCTAGTGCTCTGCCTGGCCCAGACCATCCACACGCAGGAGGGGGCCCTTCCCAGACCCTCCATCTCGGCTGAGCCAGGCACTGTGATCTCCCCGGGGAGCCATGTGACTTTCATGTGCCGGGGCCCGGTTGGGGTTCAAACATTCCGCCTGGAGAGGGAGGATAGAGCCAAGTACAAAGATAGTTATAATGTGTTTCGACTTGGTCCATCTGAGTCAGAGGCCAGATTCCACATTGACTCAGTAAGTGAAGGAAATGCCGGGCTTTATCGCTGCCTCTATTATAAGCCCCCTGGATGGTCTGAGCACAGTGACTTCCTGGAGCTGCTGGTGAAAGAAAGCTCTGGAGGCCCGGACTCCCCGGACACAGAGCCCGGCTCCTCAGCTGGGACTGTGCCAGGCACTGAAGCCTCCGGATTTGATGCACCATGA

Length: 459

View AllClose

0 Reviews

View AllClose