Human LACRT cDNA Clone BC069317 pENTR223.1 or pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL887939HU1
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
LACRT
Gene ID:
90070
Accession #:
BC069317
Plasmid:
Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
€214.00
Frequently bought together:

Description

Human LACRT cDNA Clone BC069317 pENTR223.1 or pUC Plasmid | Cusabio

Gene Name: LACRT

Gene ID: 90070

Accession Number: BC069317

Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGAAATTTACCACTCTCCTCTTCTTGGCAGCTGTAGCAGGGGCCCTGGTCTATGCTGAAGATGCCTCCTCTGACTCGACGGGTGCTGATCCTGCCCAGGAAGCTGGGACCTCTAAGCCTAATGAAGAGATCTCAGGTCCAGCAGAACCAGCTTCACCCCCAGAGACAACCACAACAGCCCAGGAGACTTCGGCGGCAGCAGTTCAGGGGACAGCCAAAGTCACCTCAAGCAGGCAGGAACTAAACCCCCTGAAATCCATAGTGGAGAAAAGTATCTTACTAACAGAACAAGCCCTTGCAAAAGCAGGAAAAGGAATGCACGGAGGCGTGCCAGGTGGAAAACAATTCATCGAAAATGGAAGTGAATTTGCACAAAAATTACTGAAGAAATTCAGTCTATTAAAACCATGGGCATGA

Length: 417

View AllClose

0 Reviews

View AllClose